Busch Lab

ZMP

exoc2

Ensembl ID:
ENSDARG00000055610
ZFIN ID:
ZDB-GENE-040426-1160
Description:
exocyst complex component 2 [Source:RefSeq peptide;Acc:NP_956898]
Human Orthologue:
EXOC2
Human Description:
exocyst complex component 2 [Source:HGNC Symbol;Acc:24968]
Mouse Orthologue:
Exoc2
Mouse Description:
exocyst complex component 2 Gene [Source:MGI Symbol;Acc:MGI:1913732]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa37041 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077962 Nonsense 880 918 27 28
ENSDART00000134337 None None 266 None 10

The following transcripts of ENSDARG00000055610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26603071)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26674374
GRCz11 20 26573464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTTGTGTCTCAGCACTAGTTTTAAGCAGGCATTGGAAGCGCTTCCA[C/T]AGCTACAGAGTGGAGCTGACAAAAAGTAAGTTACACTTCAGTATAGTTAC
Associated Phenotype:
Not determined