Busch Lab

ZMP

si:dkey-238m4.2

Ensembl ID:
ENSDARG00000055607
ZFIN ID:
ZDB-GENE-100921-78
Human Orthologue:
CGN
Human Description:
cingulin [Source:HGNC Symbol;Acc:17429]
Mouse Orthologue:
Cgn
Mouse Description:
cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa11671 Essential Splice Site Available for shipment Available now
sa15682 Essential Splice Site Available for shipment Available now
sa36111 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12730 Nonsense Available for shipment Available now
sa28647 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32088 Nonsense Available for shipment Available now
sa18067 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11671
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Essential Splice Site 403 1182 5 20
ENSDART00000131657 None None 763 None 15
Genomic Location (Zv9):
Chromosome 16 (position 24724469)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22628785
GRCz11 16 22544175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAACAGCTGGGGAGGAAGAACACAGAACTGCACCAAACACATTCAGA[G/T]TAAGAAGAAATACAYTTGTTTGCCATTATAAACATTCAGACATCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Essential Splice Site 403 1182 6 20
ENSDART00000131657 None None 763 None 15
Genomic Location (Zv9):
Chromosome 16 (position 24724355)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22628671
GRCz11 16 22544061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCATTAATTATAGTTWACCMATGTTGTTKTTGTGTGCTTTTTTTCCTCA[G/A]TCTTACTCAGTTACGTATGGACAGAGAGAACGCAGAGTCTCATGTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Essential Splice Site 447 1182 None 20
ENSDART00000131657 Essential Splice Site 40 763 None 15
Genomic Location (Zv9):
Chromosome 16 (position 24724220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22628536
GRCz11 16 22543926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGAGGAGAGAAACTGAAAACAAAGCTCAAGCTGACACAATGCACATGG[T/A]AATCACACACATAAGCACACACACACACACCCCAGAGAAAGGCTAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12730
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Nonsense 464 1182 7 20
ENSDART00000131657 Nonsense 57 763 2 15
Genomic Location (Zv9):
Chromosome 16 (position 24721252)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22625568
GRCz11 16 22540958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGARTTGATGGCATTGAGAGCTGAATTGGATGAAGCTGCAGTGCTGAGA[C/T]AAAAGCAGGAGGACATTCAGAGGCAAAGAGAGAGGGAGCTGACGGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28647
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Essential Splice Site 977 1182 15 20
ENSDART00000131657 Essential Splice Site 558 763 10 15
Genomic Location (Zv9):
Chromosome 16 (position 24713495)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22617811
GRCz11 16 22533201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACAGTGCAGAGATGCTGACAGAAAGAATCACCAGGAGCCGAGATCAG[G/A]TACATTATATTTAGTACACTCAACATTTTTGGGACCCAAAACTGAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32088
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Nonsense 980 1182 16 20
ENSDART00000131657 Nonsense 561 763 11 15
Genomic Location (Zv9):
Chromosome 16 (position 24711434)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22615750
GRCz11 16 22531140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCACATTGATGCAATGTTAATGTTTTGATATAATCTTCTGTAGATTGAA[C/T]AGCTGCGTGCAGAACTCATGCAAGAGAGATCCTCCAAACAAGACCTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Nonsense 1019 1182 17 20
ENSDART00000131657 Nonsense 600 763 12 15
Genomic Location (Zv9):
Chromosome 16 (position 24711138)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22615454
GRCz11 16 22530844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCTTTCAGATAAAGGAGTATAAGACTCGTGTAGCTGAGATGGAAGGC[C/T]AGTCACRTTCCTCCACTGGTGTCTCACAGCTGGAGAGCAAAATCCAGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3974
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Nonsense 1120 1182 19 20
ENSDART00000131657 Nonsense 701 763 14 15
ENSDART00000077998 Nonsense 1120 1182 19 20
ENSDART00000131657 Nonsense 701 763 14 15
Genomic Location (Zv9):
Chromosome 16 (position 24708193)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22612509
GRCz11 16 22527899
KASP Assay ID:
2260-9598.1 (used for ordering genotyping assays)
KASP Sequence:
TRGAGGGCTTGAGGAGGAAGGCCATCAGAGAGATGGAGGAGCAGCAGGAG[C/T]AGAAGGAGGCGCTGCAGTCCAGAGTCACAGCGCTAGAGAATGAACTCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19140
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077998 Nonsense 1120 1182 19 20
ENSDART00000131657 Nonsense 701 763 14 15
ENSDART00000077998 Nonsense 1120 1182 19 20
ENSDART00000131657 Nonsense 701 763 14 15
Genomic Location (Zv9):
Chromosome 16 (position 24708193)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22612509
GRCz11 16 22527899
KASP Assay ID:
2260-9598.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGGCTTGAGGAGGAAGGCCATCAGAGAGATGGAGGAGCAGCAGGAG[C/T]AGAAGGAGGCGCTGCAGTCCAGAGTCACAGCGCTAGAGAATGAACTCAAG
Associated Phenotype:
Not determined