Busch Lab

ZMP

Q4V9N0_DANRE

Ensembl ID:
ENSDARG00000055591
Description:
LOC558601 protein [Source:UniProtKB/TrEMBL;Acc:Q4V9N0]
Human Orthologue:
PIPOX
Human Description:
pipecolic acid oxidase [Source:HGNC Symbol;Acc:17804]
Mouse Orthologue:
Pipox
Mouse Description:
pipecolic acid oxidase Gene [Source:MGI Symbol;Acc:MGI:1197006]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa13980 Essential Splice Site Available for shipment Available now
sa22647 Essential Splice Site Available for shipment Available now
sa39043 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13980
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Essential Splice Site 46 397 1 8
Genomic Location (Zv9):
Chromosome 15 (position 23532273)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24243460
GRCz11 15 24178725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCCTATCAGCTGGCCAARAACAAGCAGAAAACTCTGCTGCTGGAGCAG[G/A]TCGGTTACCGYCAGATTTTTTACTGTATTRAAAGCAAGACACGTGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22647
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Essential Splice Site 168 397 4 8
Genomic Location (Zv9):
Chromosome 15 (position 23520962)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24232149
GRCz11 15 24167414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGGTGCTCTTATTAGGATGAGATGTTTTGAATGTGTGTGTGTTGTTC[A/C]GAGGCTGTTTCAGTGCAGTGGTGGAGTGCTGAAGGACGGGCAGACAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7759
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Essential Splice Site 228 397 4 8
Genomic Location (Zv9):
Chromosome 15 (position 23520777)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24231964
GRCz11 15 24167229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGGGCAAACACACKACTCGCACACGCTGGACTGCAGCTGCCGCTCAAG[G/A]TCACTATCTCTCACACACACACATACTATACACACAAACACACAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39043
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Nonsense 261 397 5 8
Genomic Location (Zv9):
Chromosome 15 (position 23518381)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24229568
GRCz11 15 24164833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACAGTGTCGACCAGAGCTTTCCATGCTTTATACAGATGGAGCCGAAA[G/T]AGGGGGAATATGACATTTATGGCCTTCCATCCAATGAATATCCAGGACTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa432
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Nonsense 375 397 8 8
Genomic Location (Zv9):
Chromosome 15 (position 23504448)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24215635
GRCz11 15 24150900
KASP Assay ID:
554-0284.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAGTTTAGCCCCATCATTGGAAAGGTGCTCTCTCAGCTGGCCATGGGG[C/T]AGGTTCCCTCACATGACCTCTCACCTTTCCGAATTCAACGCTTCCAGTCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461