Busch Lab

ZMP

cacnb2b

Ensembl ID:
ENSDARG00000055565
ZFIN ID:
ZDB-GENE-050208-129
Description:
calcium channel, voltage-dependent, beta 2b isoform 2 [Source:RefSeq peptide;Acc:NP_001159796]
Human Orthologues:
CACNB1, CACNB2, CACNB3, CACNB4
Human Descriptions:
calcium channel, voltage-dependent, beta 1 subunit [Source:HGNC Symbol;Acc:1401]
calcium channel, voltage-dependent, beta 2 subunit [Source:HGNC Symbol;Acc:1402]
calcium channel, voltage-dependent, beta 3 subunit [Source:HGNC Symbol;Acc:1403]
calcium channel, voltage-dependent, beta 4 subunit [Source:HGNC Symbol;Acc:1404]
Mouse Orthologues:
Cacnb1, Cacnb2, Cacnb3, Cacnb4
Mouse Descriptions:
calcium channel, voltage-dependent, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:102522]
calcium channel, voltage-dependent, beta 2 subunit Gene [Source:MGI Symbol;Acc:MGI:894644]
calcium channel, voltage-dependent, beta 3 subunit Gene [Source:MGI Symbol;Acc:MGI:103307]
calcium channel, voltage-dependent, beta 4 subunit Gene [Source:MGI Symbol;Acc:MGI:103301]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10313 Essential Splice Site Available for shipment Available now
sa16129 Essential Splice Site Available for shipment Available now
sa31283 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10313
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049219 Essential Splice Site 282 374 10 14
ENSDART00000123495 Essential Splice Site 282 600 10 13
ENSDART00000126594 Essential Splice Site 285 377 11 14
ENSDART00000130722 Essential Splice Site 285 377 11 15

The following transcripts of ENSDARG00000055565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31219352)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31520412
GRCz11 2 31503630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACCTCCTTGGCCCCGATCCTGGTGTATGTCAAGATTTCATCCCCCAAG[G/A]TCAGAAACATTGTYCACAGAACTCACAGACATAACCATCATTTATTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049219 Essential Splice Site 282 374 None 14
ENSDART00000123495 Essential Splice Site 282 600 None 13
ENSDART00000126594 Essential Splice Site 285 377 None 14
ENSDART00000130722 Essential Splice Site 285 377 None 15

The following transcripts of ENSDARG00000055565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31219353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31520413
GRCz11 2 31503631
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCTCCTTGGCCCCGATCCTGGTGTATGTCAAGATTTCATCCCCCAAGR[T/G]CAGAAACATTGTTCACAGAACTCACAGACATAACCATCATTTATTACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31283
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049219 Essential Splice Site None 374 None 14
ENSDART00000123495 None None 600 None 13
ENSDART00000126594 None None 377 None 14
ENSDART00000130722 Essential Splice Site None 377 None 15

The following transcripts of ENSDARG00000055565 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 31224480)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31525540
GRCz11 2 31508758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAACTCTCTTGGACATTTAAAGAAGACTTGAACTTAAAGGACCTCTGG[T/C]AAGTGGGAAGATGGTGGTTCCTGAGGTAAAATACCTATAGTGTTAGTACC
Associated Phenotype:
Not determined