Busch Lab

ZMP

cmn

Ensembl ID:
ENSDARG00000055527
ZFIN ID:
ZDB-GENE-000208-9
Description:
calymmin [Source:RefSeq peptide;Acc:NP_571089]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa22049 Essential Splice Site Available for shipment Available now
sa22050 Nonsense Available for shipment Available now
sa12588 Nonsense Available for shipment Available now
sa22051 Essential Splice Site Available for shipment Available now
sa3334 Essential Splice Site F2 line generated Not yet available
sa41981 Nonsense Mutation detected in F1 DNA Not yet available
sa2627 Essential Splice Site F2 line generated Not yet available
sa35227 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22049
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 348 1207 21 54
ENSDART00000124453 Essential Splice Site 348 1249 21 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14239177)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13094830
GRCz11 12 13133133
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATAGCTAACTGAAGCACCTCTAAATGGATTTGGGATTGTTTGTTGTTC[A/G]GGAAATGGAGGATATCCTAATGGAGGCGCAACTAGTCAACATAATGGAGG
Long Flanking Sequence:
CTGAATCACCTCTGAACTGCTTTTTGTTCAGGATATGGAGGATATCCCAATGCAGGTGCAACTAACCAGCCAAATGGGGGTAATATGAACGTCACCAGCTCTTTCATATAGATTTAATTTTACAGTGTTACTATTATAGTGCAGATGATACTACATTAAAGAACTGGGTAAAGCATAACTGGTCTAAATGAGACTTTCTTGAAATTATTTTTGTCTTAATAGGGCCATTTCAAAATATGGGTTACCCCAATGGTGGAACCAAGGGCCCTAAACCAGGTAAACATTTTTGTTTGAGTGCAGTGTGTATGGCACCTATTTCTTTTTTTTATACATAAATGATATGAATATTATTTGTGATATCTGTTTCAAAGGATATGGTGCTAAAGCTGGACCCTCGGCTGGACATGTAGCCAAGCCTAATGGTACATAAAATTTAATTATTTATTGTAAAGATAGCTAACTGAAGCACCTCTAAATGGATTTGGGATTGTTTGTTGTTC[A/G]GGAAATGGAGGATATCCTAATGGAGGCGCAACTAGTCAACATAATGGAGGTAATGGGAATTTCACCATCTCTTTTTTTTAAATAGACTTTTACAGTGTAATTTTCACAGTGCAGATGAAACTAAATTAAGGAACTTGGGAAACTACAAACCCATTTCCAAAAAAGTTGGGACACTGTACAAATTGTGAATAAAAAAGTAATGCGCTAATTTACAAATCTCATACACTTATATTTTGTTTACAATAGAATATAGATAACCGAATCTAGATGCCGACAGCTAGCTCTCTGCAACAGTATGGTGACAGGGACTCTATACTGCTCAATGAGCACTGTCTTTCGGATGAGAAGTTAAACCGAGGTCCTGACTCTCTGTGGTCTTTAAAAATCCAAGAATGGCCTTCGCAAAAGAGTAGGGGGTTTAACCCTGGTATCCTGGCCATATTTGCCCACTGGCCTTTGTCCATCATGGCCTCCTAACCATCCCCATATCATAATTGGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27913
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 399 1207 23 54
ENSDART00000124453 Essential Splice Site 399 1249 23 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14241209)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13096862
GRCz11 12 13135165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGGTGCGAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAATGG[T/G]AAATAGTATTCATTTATTTAATTATTTATTTAAATGGAGGTAACCCATCA
Long Flanking Sequence:
CCATACCAAATACTGCATCAATCACATCATGGATGCTTAGAAGAGAGATCCAGGTACTAAAAACAGCCAGCTTGCAGTCTAGATCATTTACCCATAGAAAACATTTGGCGCATGACTAAGATGAAGATGCAACAAAGAAGACCTAATTTGAGTAGCTAGCAGGTATTTGAGCAGCTAGAAGCTTGTATTAGACAAGAATACCAACTTCTTGGGATTACTTGTAGAGTAATCAAAATAAGACTTAATTTAAATTATTCTTGTCTTATTAATTAGGCTCTTCTCAATTTATGGGTTATCCCAATGGAGGAACCAAGGGACCTAAATCAGGTGAATATCCTTTTTTTTTTTATTGAGTGCAGTGTGTATGGGGTGTATATTTTATATTTCTTACTATTTATTTGTATTTCCACATCTGAATCGAATTTTATTTGTGATGTCTACTTCTAAGGATATGGTGCGAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAATGG[T/G]AAATAGTATTCATTTATTTAATTATTTATTTAAATGGAGGTAACCCATCAGAACTGATTTATAGTTGGTTTTTGTTCAGGAAATGGAAGATATCCTATTGGAGGCGTTGCAAACCAGCCTAATAGGGGTAATACACATGTCACCAGCTTATTTATATAGATTTAATTTTACAGTGTAATTATTATAGTGCAGATGATACCAAATTAAAGAACTAGAGAAACTACACGGGTCTAAATGAGACTTGAAATTATTCTTTTATTAGGATCCTCTCAAAATATGGGCTATCCCAATGGCAGAACTAAGGGACCTAAACAAGGTAAACTTTTTTTGAATGCAGTGTATATGATGTGTATTTTTTATATTTGATTTTAATCTTATTTGTGATGTCTGCTTTTGAAGGATATGGTGCTAAAGCCGGATCTTTAGCTGGACAAGTAGCCAAGCCTAATAGTAAATAGCATTAATTTGTTAATTTATTTATTTAAATAAATATATTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22050
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 437 1207 26 54
ENSDART00000124453 Nonsense 437 1249 26 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14242095)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13097748
GRCz11 12 13136051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCATTTAAACTGATTTGGGATTTTTTTTGTTCAGGATATGGAGGATA[T/A]CCTAATGGAGGCGCAGCTAACCAGCCTAATGGGGGTAATATGAATGTCAC
Long Flanking Sequence:
GTCTGCTTTTGAAGGATATGGTGCTAAAGCCGGATCTTTAGCTGGACAAGTAGCCAAGCCTAATAGTAAATAGCATTAATTTGTTAATTTATTTATTTAAATAAATATATTTTGCAAAAGATGTATGGATGCAGTCCTCCAAGCTCATGCCAGTCATACCCAATATTAATTCTTTCTTCACTGCACCGTGACTTTATATTCTGTACTGTACATTATTTCTGTTAAGTGACTTGTATAAGTCAGACCTTACTGTCCTATTTAAACATTTAAAAATCAAATCATTATCAGATTTTATTTTGGTAAAAGAAGCGTAATTTAGAGGCCTTTGCATTTTATATAAGCCACTTCTGATATCAAATGATCAACTAGAAGTCAAGTTATTATTTCTTGTTCTTACAACTTGGATAGGTGTCAAGACTTTTGTCAGGTAGTGTAAATAGAAGGAACTGACATGCATTTAAACTGATTTGGGATTTTTTTTGTTCAGGATATGGAGGATA[T/A]CCTAATGGAGGCGCAGCTAACCAGCCTAATGGGGGTAATATGAATGTCACCAGTTATTTTATAGAGATTTAATTTTACAGTTTAACTATTACAGTGCAGATGACTCTCGGGGAAACTACATGAGAATTCAACTTTCTCGAAATTATACTTGTCTTATTAGGATCCACTCAAAATATGGGTTATTCCAATGGTGGAACCAAGGGACCTAAACAAGGTAATTTGTTTTTTTCTGCAGTGTGTATGTTGTGTATTTTAAGATTTATAATTTGAATCTTATTTGTGATCTCTGCTTCAAAGGATATGGTGCTAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAATGGTAAACTGTATTAAATTAGTTAACTATTAATTGTTACAGTTCTAAACTGATCTGTGATTGGTTTTGTTCAGGATATGGAGGATATCCTAATGGTGGTGCAACTAACCAGCCTAATGGGGGTAATATGAATGTCACGAACACTTTTTACATAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7690
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Splice Site, Nonsense 484 1207 28 54
ENSDART00000124453 Splice Site, Nonsense 484 1249 28 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14242443)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13098096
GRCz11 12 13136399
KASP Assay ID:
2260-5092.1 (used for ordering genotyping assays)
KASP Sequence:
GATATGGTGCTAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAAT[G/T]GTAAACTGTATTAAATTAGTTAACTATTMATTGTTACAGTTCTAAACTGA
Long Flanking Sequence:
TGATATCAAATGATCAACTAGAAGTCAAGTTATTATTTCTTGTTCTTACAACTTGGATAGGTGTCAAGACTTTTGTCAGGTAGTGTAAATAGAAGGAACTGACATGCATTTAAACTGATTTGGGATTTTTTTTGTTCAGGATATGGAGGATATCCTAATGGAGGCGCAGCTAACCAGCCTAATGGGGGTAATATGAATGTCACCAGTTATTTTATAGAGATTTAATTTTACAGTTTAACTATTACAGTGCAGATGACTCTCGGGGAAACTACATGAGAATTCAACTTTCTCGAAATTATACTTGTCTTATTAGGATCCACTCAAAATATGGGTTATTCCAATGGTGGAACCAAGGGACCTAAACAAGGTAATTTGTTTTTTTCTGCAGTGTGTATGTTGTGTATTTTAAGATTTATAATTTGAATCTTATTTGTGATCTCTGCTTCAAAGGATATGGTGCTAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAAT[G/T]GTAAACTGTATTAAATTAGTTAACTATTAATTGTTACAGTTCTAAACTGATCTGTGATTGGTTTTGTTCAGGATATGGAGGATATCCTAATGGTGGTGCAACTAACCAGCCTAATGGGGGTAATATGAATGTCACGAACACTTTTTACATAGATGTAATTTTTCAGTATAGTTATGGCAGAGCATATGTTGCTAATTTAAAGCACTTTTAAAAACAATTATTGTTGCCCTACTAGGCTCCTCTCAATATATGGGTTATCCCAATGGTGGAGCCAAGGGACCTAAAGCAGGTAAACCTTTTAATGTGCAGTGGGTATGGTGGTTATTTTTAATCAATTATTTGTTTGTTTGTTTTTTTGTTTTTTTTACATCTGATTTGAGTCTTATTTGTGATGTCTGCTTTAAAGGATATGGTGCTAAATCTGGACCTTCATCTGGACAAGTATCCAAGCCTAATGGTAAGTGATTTTAATGTAATCTGATTATTAATGTTATTATTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5597
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 517 1207 30 54
ENSDART00000124453 Essential Splice Site 517 1249 30 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14242733)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13098386
GRCz11 12 13136689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCAATATATGGGTTATCCCAATGGTGGAGCCAAGGGACCTAAAGCAG[G/A]TAAACCTTTTAATGTGCAGTGGGTATGGTGGTTATTTTTAATCAATTATT
Long Flanking Sequence:
CGAAATTATACTTGTCTTATTAGGATCCACTCAAAATATGGGTTATTCCAATGGTGGAACCAAGGGACCTAAACAAGGTAATTTGTTTTTTTCTGCAGTGTGTATGTTGTGTATTTTAAGATTTATAATTTGAATCTTATTTGTGATCTCTGCTTCAAAGGATATGGTGCTAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAATGGTAAACTGTATTAAATTAGTTAACTATTAATTGTTACAGTTCTAAACTGATCTGTGATTGGTTTTGTTCAGGATATGGAGGATATCCTAATGGTGGTGCAACTAACCAGCCTAATGGGGGTAATATGAATGTCACGAACACTTTTTACATAGATGTAATTTTTCAGTATAGTTATGGCAGAGCATATGTTGCTAATTTAAAGCACTTTTAAAAACAATTATTGTTGCCCTACTAGGCTCCTCTCAATATATGGGTTATCCCAATGGTGGAGCCAAGGGACCTAAAGCAG[G/A]TAAACCTTTTAATGTGCAGTGGGTATGGTGGTTATTTTTAATCAATTATTTGTTTGTTTGTTTTTTTGTTTTTTTTACATCTGATTTGAGTCTTATTTGTGATGTCTGCTTTAAAGGATATGGTGCTAAATCTGGACCTTCATCTGGACAAGTATCCAAGCCTAATGGTAAGTGATTTTAATGTAATCTGATTATTAATGTTATTATTAATGTAAGCTGAGGTAATTTAAGAACCTCTAAAGGATAAGTATATCATAATTTTGGTCCAGCTAAATAACCTAATAGAACTAATGTTTTAGATGTCATCCGCTCTAAAGTGTAGATAATAGTGAGTTCTAAATATTACATTGACTTTTTTTGTCTAATCAGGCTCCTCTCAATATATGGGGTATCCCAATGGTGGAACCAATGGACTTAAACCAGGTAAACTTTCAGGATGTGTGATGTTTAATATGTGTGTATCACTTCTTTTACAAATCATTTGATTTTTATTCTGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12588
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 572 1207 34 54
ENSDART00000124453 Nonsense 614 1249 36 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14245389)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13101042
GRCz11 12 13139345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATGTAAACTTTTAACTGTCATATTAACTTTCTTGTGACCTACAGGTTA[C/A]GGTGTTCCTGGATATAYGTCAAAAGGACCTAAAGCAGCWAATTCAGGTAA
Long Flanking Sequence:
TACAGATGTTTTTACAGATTTTTGCCAAACTACATAGGCATCTTGGTTAAAACAAGGCTAAGTTTGGGCTGTTTGTAAAAATTTAATAGAACTTAAACGCATATTAAAATTAAATACACATATTAGAAAGACTTTGCATGTGTAGTTATTCATTCTAGTCTATTTGACTTGGGGATGACAGGCTGATGTTTGGCTATCCTTAGACATCTATTAGATTTTTACTGACTGTCCAAATTTAGTCTAGTTTTAGCCAAGATATCTATTTTTAATTGTCTCTACATAGTCTTTTAAATAGATAAAGTGCTTATTGGGAAGCCACTGTGTTGACTGCATATTATTTTAATTTCTTATTTATGCAAATTCTAATCCCATTCAGAATAATATAATAATAAAATTGTTTCATTTTATGAATCTACTTTTAGATCCGGTTTTACTCAAATAAGCATGATCTAATGTAAACTTTTAACTGTCATATTAACTTTCTTGTGACCTACAGGTTA[C/A]GGTGTTCCTGGATATACGTCAAAAGGACCTAAAGCAGCTAATTCAGGTAAAATTATAAGTGCATTTACTTCCTCCACATGACATGATTAGTGACATTTTGTAATCTGTCTTTGAGAAATGCATGTATTTCCCTGCGTTTACGTTTGTCATGTTGACTTCTCAGTTTTGTAATAAAATGGGTTTGTTTTCTAGGGTATATGCCTGTAATAACTGGAAATAAGGGTGCTTCAATTGGAAAGGGGCCAAAGGGGGAGATTTTAAGTGCTGAAGCACCAAGTCAAGCACCACTGTCCAACACAAAGGGTGTTCTACCAGTTGCTCAACAAGAACCAGTTACAGGATTACTTCCAAATCAGGGAACTAAAGGCCTTCCAGTTCTGCAACAAACAAAGGGACAAATTCTTCAAGCATCATTACCACAGAGTAAAACCCAAAACTCTATGGTACCTCAGTTTGCTTCAAACCCATTTATGCAGGGCCCTAGCTCTTACAAACCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22051
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 790 1207 35 54
ENSDART00000124453 Essential Splice Site 832 1249 37 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14246189)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13101842
GRCz11 12 13140145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAACCCTGCTTTGCCTCAGTTGAAGAATCCAACCACAACAAATCCTGG[T/C]AAATCTCTAAAGTTTCAGATTAAAATGTTACATGATCTCCTCTAACTGTA
Long Flanking Sequence:
AAGGGTGTTCTACCAGTTGCTCAACAAGAACCAGTTACAGGATTACTTCCAAATCAGGGAACTAAAGGCCTTCCAGTTCTGCAACAAACAAAGGGACAAATTCTTCAAGCATCATTACCACAGAGTAAAACCCAAAACTCTATGGTACCTCAGTTTGCTTCAAACCCATTTATGCAGGGCCCTAGCTCTTACAAACCTAGTAAAATGTATAAACCACCAACATCTACAATTCCAATTGAAAAGCCAGAGATTCCAGTAATTCCTCAGTCAGTGCCTGCACCAGAATCTGCGTTCATTCCTCAAACATCACAGACAACTCCACTAGAGCAGGAGCAAGTCCTTTCATTGGAACAGAAAAGTCAAGTGACCGCACAACCAGTTACACAACAAGGCAGCATTTCTTCTCAGGCGGCTCAATCAACTCCAGTTTTGCAGCAAGCAGAAATACAGTCAAACCCTGCTTTGCCTCAGTTGAAGAATCCAACCACAACAAATCCTGG[T/C]AAATCTCTAAAGTTTCAGATTAAAATGTTACATGATCTCCTCTAACTGTATAGCAACTTGAAGTTGTTACAGCGTTTAACTTTCACTTTGTGCACAATCATTAAAAACAAAAAGGAAAAGTGAACCACCAGTAATGACTGCTTGTATGTGTCTGTAAATGCCCACTCAAATTATTCTAAAAACCTGGCCTTTTGTTTCACAACTATCATTTCAAAATTTGGAAGAGGTGGCTAATATCTGGATTTACTTATCTTTTGCTGTCAACTAGCATTAAACTCGGCTTCTTTTAACTGATCTCTTTTTGTGTTCCACAGAACTCACTGGTCTAGAACAACCTAATGGTCAGGTGCAGGGTGCTGTGCCGGCAAAGCCTGGTAAATCATAAATAGTACTCCAATTAGTTACATTAAAATACATCCCAGAGTAATTAGCAGTTCATCCATTTATCTGCTCTCTTGTAACTCTCTTGTTAATATTTTCTTAGACTGTGGACCTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3334
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 875 1207 41 54
ENSDART00000124453 Essential Splice Site 917 1249 43 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248811)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104464
GRCz11 12 13142767
KASP Assay ID:
554-2450.1 (used for ordering genotyping assays)
KASP Sequence:
GTGACCAGGTTTTCTTTRAGACAACTAAATGTCTTTTCTGTTACTTTGAT[A/G]GCTGGACTACAAGGTGGACCACCAGCACGATTGGGAACAAAGGGAAAATC
Long Flanking Sequence:
TATAATTCCAGGGCCTTATTTTGCAATATGTTACCTACAAAAATAAGAATAACACTTTATATAAATAAATAAATAATATTTATTTATTTATTTTTTATATATAAAGGTTTACAAAATATTTGTCCATGTTTTTTCTGCTTGTGCCTCAGACTGTATATGTTGTAAACTGCTTTAAATAGTGTGTGTAGTTTTTTGTGTGCTGTAAGTTTTTCGATAACACTTTATTTTGATGGTCCATTTCAGTATTAGTAGACAATCTGCTTTATATCTGTTGATATTGCTCTATCAACAGACATTTAACTGAATATTAGAGACTTTGCAAGTACTGTACATGTCAACTTACACTAACCCTAACCCCAATTTAACAGTCTATTTATAATCTAATGATAATTAGTTGGCAAGTACATGCAATGTAACTTAAATTCAACAAATGGACCATCAAAATAAAGTGTGACCAGGTTTTCTTTAAGACAACTAAATGTCTTTTCTGTTACTTTGAT[A/G]GCTGGACTACAAGGTGGACCACCAGCACGATTGGGAACAAAGGGAAAATCTCAAACAAAATATGGTTAGTCTTAGGAGGAAAATGTAAAAATTTTAAAACTAATTATGTTGTTAACAATTGTTTGTCAACAATAACTTTTTTTATTTTTCTAATTTTGTCAGGAATTGGTGGACTTCCCTTTGGTGGTTCCCCCAGTGGATATCAGTCCAACCCCTACGGACAATATGGTATGTTATCAGTTTCTTACAATATTGCACTATGTAATGTAAGCATTGTCCCTGACAGTAGTTCTGACTGGATTAGTGGTGTGTTATTTTTCATAGGTAATGATGGTCAGCGATATGGAGCTAAACCCTACAATCCTAAAGCACCAGGAAAATACGGTGATGATTAGATGTTTTAATGTTCCTTTGCGCTTTTTAATAATTGTTCGAGTGCCTTCATAGAATATCAGGCAGTGTATAGCATTGCTTATGGTAAATGAAGTTAGCAGATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41981
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 886 1207 41 54
ENSDART00000124453 Nonsense 928 1249 43 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248845)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104498
GRCz11 12 13142801
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTTACTTTGATAGCTGGACTACAAGGTGGACCACCAGCACGATTG[G/T]GAACAAAGGGAAAATCTCAAACAAAATATGGTTAGTCTTAGGAGGAAAAT
Long Flanking Sequence:
CTACAAAAATAAGAATAACACTTTATATAAATAAATAAATAATATTTATTTATTTATTTTTTATATATAAAGGTTTACAAAATATTTGTCCATGTTTTTTCTGCTTGTGCCTCAGACTGTATATGTTGTAAACTGCTTTAAATAGTGTGTGTAGTTTTTTGTGTGCTGTAAGTTTTTCGATAACACTTTATTTTGATGGTCCATTTCAGTATTAGTAGACAATCTGCTTTATATCTGTTGATATTGCTCTATCAACAGACATTTAACTGAATATTAGAGACTTTGCAAGTACTGTACATGTCAACTTACACTAACCCTAACCCCAATTTAACAGTCTATTTATAATCTAATGATAATTAGTTGGCAAGTACATGCAATGTAACTTAAATTCAACAAATGGACCATCAAAATAAAGTGTGACCAGGTTTTCTTTAAGACAACTAAATGTCTTTTCTGTTACTTTGATAGCTGGACTACAAGGTGGACCACCAGCACGATTG[G/T]GAACAAAGGGAAAATCTCAAACAAAATATGGTTAGTCTTAGGAGGAAAATGTAAAAATTTTAAAACTAATTATGTTGTTAACAATTGTTTGTCAACAATAACTTTTTTTATTTTTCTAATTTTGTCAGGAATTGGTGGACTTCCCTTTGGTGGTTCCCCCAGTGGATATCAGTCCAACCCCTACGGACAATATGGTATGTTATCAGTTTCTTACAATATTGCACTATGTAATGTAAGCATTGTCCCTGACAGTAGTTCTGACTGGATTAGTGGTGTGTTATTTTTCATAGGTAATGATGGTCAGCGATATGGAGCTAAACCCTACAATCCTAAAGCACCAGGAAAATACGGTGATGATTAGATGTTTTAATGTTCCTTTGCGCTTTTTAATAATTGTTCGAGTGCCTTCATAGAATATCAGGCAGTGTATAGCATTGCTTATGGTAAATGAAGTTAGCAGATTGTTATGAAATAATTTGTTTTGCTGTCATGTACACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2627
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 896 1207 41 54
ENSDART00000124453 Essential Splice Site 938 1249 43 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248877)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104530
GRCz11 12 13142833
KASP Assay ID:
554-2508.1 (used for ordering genotyping assays)
KASP Sequence:
GGACCACCAGCACGATTGGGAACAAAGGGAAAATCTCAAACAAAATATGG[T/C]TAGTCTTAGGAGGAAAATKTAAAAATTTTAAAACTAATTATGTTGTTAAC
Long Flanking Sequence:
AAATAAATAATATTTATTTATTTATTTTTTATATATAAAGGTTTACAAAATATTTGTCCATGTTTTTTCTGCTTGTGCCTCAGACTGTATATGTTGTAAACTGCTTTAAATAGTGTGTGTAGTTTTTTGTGTGCTGTAAGTTTTTCGATAACACTTTATTTTGATGGTCCATTTCAGTATTAGTAGACAATCTGCTTTATATCTGTTGATATTGCTCTATCAACAGACATTTAACTGAATATTAGAGACTTTGCAAGTACTGTACATGTCAACTTACACTAACCCTAACCCCAATTTAACAGTCTATTTATAATCTAATGATAATTAGTTGGCAAGTACATGCAATGTAACTTAAATTCAACAAATGGACCATCAAAATAAAGTGTGACCAGGTTTTCTTTAAGACAACTAAATGTCTTTTCTGTTACTTTGATAGCTGGACTACAAGGTGGACCACCAGCACGATTGGGAACAAAGGGAAAATCTCAAACAAAATATGG[T/C]TAGTCTTAGGAGGAAAATGTAAAAATTTTAAAACTAATTATGTTGTTAACAATTGTTTGTCAACAATAACTTTTTTTATTTTTCTAATTTTGTCAGGAATTGGTGGACTTCCCTTTGGTGGTTCCCCCAGTGGATATCAGTCCAACCCCTACGGACAATATGGTATGTTATCAGTTTCTTACAATATTGCACTATGTAATGTAAGCATTGTCCCTGACAGTAGTTCTGACTGGATTAGTGGTGTGTTATTTTTCATAGGTAATGATGGTCAGCGATATGGAGCTAAACCCTACAATCCTAAAGCACCAGGAAAATACGGTGATGATTAGATGTTTTAATGTTCCTTTGCGCTTTTTAATAATTGTTCGAGTGCCTTCATAGAATATCAGGCAGTGTATAGCATTGCTTATGGTAAATGAAGTTAGCAGATTGTTATGAAATAATTTGTTTTGCTGTCATGTACACTTTGTACAGTGGGTAGGGAAAATATCCAGACCCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4456
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 975 1207 45 54
ENSDART00000124453 Nonsense 1017 1249 47 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14250449)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13106102
GRCz11 12 13144405
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTTGGAGGGTTTCCCTACAATGGCCAGCCACTTGGATATGGCAGTGGC[A/T]AATCCACTGGCAAATATGGTGAATGNNNNNNNNNNNTTTTTTTCTTTTAACTTTTAAAAAR
Long Flanking Sequence:
CACCCTCACAGCATGATGCTGCCACCACCTGCTTCACTGTTAAGACAGGTGATGAGCAGTGCCTGGTTTTCTCCACCCATACTATTTAGAAATTAGGCCAAAGAGTTCTATCTTGGTTCCAGAGAATCTATTTTCTCACCATCTTGGGGTCCTTCAGGTTTTTTTTAGCGAACGCCATGCAGTTTTTTTTGTGGCAAGCCACGTTGCCATTAAGCCCAGACTGGTGGAGGGCCATGTTATCATGTCCATGTTGTTTGTTTAACCTAATGATTTTATTTTCTTATGTCAAAACAGGATATGGTAGTTTACCATACAACTCTCAGGCTTTTCCAGAATCAGTTGCCAGATCACCTGGTAAATATAGTTAAGATATATCTTTGATCAAAGAGTGTATTTTGTTTTTGAAGATTTTTTTTTTATTTATTTAATTATGAGCTTCTGTATTTTCAGATTTTGGAGGGTTTCCCTACAATGGCCAGCCACTTGGATATGGCAGTGGC[A/T]AATCCACTGGCAAATATGGTGAATGTTTTTTTCTTTTAACTTTTAAAAAGACGATGTTTTTTGATTGGCTTCATTAAACATGGACCTTCAGCATGCACTTGGGCAATTTGCTGCTGAGTGTGATGCAGCTGGGAGAATCAGTGGGAGAAAAGTCCTTACTCCAAGTGGAGGAGTTCAAGTACCTTGGGGTTTTTTCACAAGTGAGGGAAGGATAGAACATGAGATTTACAGGTGGATCAGTGCAGCGGCATCTGTAATGCGGTCAATGTACCGGTCTGTTGTGGTAAAGAAGAAGCTGAGCCGAAAGGTAAAGCTCTCGATTTACCTGTGTATTTACGTTCCTACTTTCACCTATGGTCATGAGCTTTGGCTCATGACTGAAAAGACAAAATCTTGGATACTTGGCCGAAATGACTTTCCTTCGCTTATAGATAGGATAAGGAGCTCTGTCACACGGGAGGAACTTGGAGTAGAGCCGCTGCTCCTCCACATTGAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35227
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 990 1207 46 54
ENSDART00000124453 Nonsense 1032 1249 48 56
ENSDART00000127870 None None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14251316)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13106969
GRCz11 12 13145272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTTTACTGTCATTTTTTTCAGGACAAAAGGGTCCTCAATATGGTGGT[C/T]AGTCCCTTGGTCACGGGCCTGATGCAATTTCTGGAAAATACGGTGACAAC
Long Flanking Sequence:
TTGGCTCATGACTGAAAAGACAAAATCTTGGATACTTGGCCGAAATGACTTTCCTTCGCTTATAGATAGGATAAGGAGCTCTGTCACACGGGAGGAACTTGGAGTAGAGCCGCTGCTCCTCCACATTGAGAGAAGCCAGCTGAGGTGGCTTGGGCATCTGTTTCAAATGCCTTCTGGATGCCCACCTAGGGAGGTGTTTCAGGCAGGTTCTCCTGGGAGGAGGCCTTGGGGAAGACCCAGGACACTCTGGAGTGACTAGAGTACGTCTCTAGGCTGGCCTGGGAACGACTCGGGATTCCCCCGGAGGAGCTGGAGGAAGTGTCTGGGATGAGGGTAGTCTGGGGTTCTCTCCTGAGACTGCTGCCCCTACGACGCAGCCCTGGAAAAGCAGATGAAAATTAAAGAATGAAAGCATGAATGAATTAATAACTTTTTTGATTTAAAGTGAATGTCTTTTACTGTCATTTTTTTCAGGACAAAAGGGTCCTCAATATGGTGGT[C/T]AGTCCCTTGGTCACGGGCCTGATGCAATTTCTGGAAAATACGGTGACAACAAATGCTTTTTATAGATGATCATATGACAATGATATTATAATATTATTGTACTAATACTTATTCTCATACTCTCCACACCTTTCAGGGTCTCCTGAATCCTTGTACACACCAGAAACGGTCAATCTTGGAGGCAATGCCAAATCAACTAAATATGGTATGACAGTTTCTTTTTCATATCTTTTCTTTTAATTTATTTAGGTTTTGGTTTAAATTACAATTCCTCTGTATGTGAATTGTGGCTAACATCATACAGTTAGGCTAATGAAACAGTCAAACTGAGTTACTGGAGAGGCTGAGGCTCTGCACAGTTTAGTTCCAACCCTAATTAAACACACCTGATCAAACTGATTGAGTCCTTCTAGCTTGTTTGAATCCTACAGGTAATGCCGCAGTCACACTAAAGTTTGAGCTTGCGAAATTCTGTCTTACGGTGCTGCAAAAAGGGGCAG
Associated Phenotype:
Not determined