Busch Lab

ZMP

si:ch211-101n13.9

Ensembl ID:
ENSDARG00000055525
ZFIN ID:
ZDB-GENE-030616-570
Description:
hypothetical protein LOC368889 [Source:RefSeq peptide;Acc:NP_001007175]
Human Orthologue:
AC008074.1
Human Description:
Galectin-related protein [Source:UniProtKB/Swiss-Prot;Acc:Q3ZCW2]
Mouse Orthologues:
1110067D22Rik, Gm5065
Mouse Descriptions:
RIKEN cDNA 1110067D22 gene Gene [Source:MGI Symbol;Acc:MGI:1916114]
predicted gene 5065 Gene [Source:MGI Symbol;Acc:MGI:3643170]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22291 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4502
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077896 Essential Splice Site 40 180 2 5
ENSDART00000147907 None None 145 None 2
Genomic Location (Zv9):
Chromosome 13 (position 24772087)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24417747
GRCz11 13 24548197
KASP Assay ID:
2260-6397.1 (used for ordering genotyping assays)
KASP Sequence:
AGAYGCTGGGCTMATTTCTCCTGACAAAGAAGACATCTCTCGCATTYTGG[T/A]AGAGTAAWATGCAAAAAAAAATTTTTTAATTGAAYTAAACTGTAATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22291
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077896 Nonsense 75 180 4 5
ENSDART00000147907 Nonsense 40 145 1 2
Genomic Location (Zv9):
Chromosome 13 (position 24776262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24421922
GRCz11 13 24552372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCATACAGTTCTGAATGTTGGTTTTCTGCACAGCTTTGACATCAGTT[T/A]AACCTGTGGCCACAATGAGGAGAAAGAGGATGAAAAGCTCGCTGATGTGG
Associated Phenotype:
Not determined