Busch Lab

ZMP

pygma

Ensembl ID:
ENSDARG00000055518
ZFIN ID:
ZDB-GENE-050522-482
Description:
glycogen phosphorylase, muscle form [Source:RefSeq peptide;Acc:NP_001018464]
Human Orthologue:
PYGM
Human Description:
phosphorylase, glycogen, muscle [Source:HGNC Symbol;Acc:9726]
Mouse Orthologue:
Pygm
Mouse Description:
muscle glycogen phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97830]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31059 Nonsense Mutation detected in F1 DNA Not yet available
sa39334 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31059
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077871 Nonsense 75 842 1 20
Genomic Location (Zv9):
Chromosome 21 (position 27839737)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28408648
GRCz11 21 28445343
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTCAGAGACCACTTGGTAGGCAGATGGATCAGAACACAGCAGAGTTA[T/A]TACGAGAAAGACCCCAAAGTAAGTTCATGCATGTCGAGCTAAAGCAAAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7963
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077871 Nonsense 297 842 8 20
Genomic Location (Zv9):
Chromosome 21 (position 27854209)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28423120
GRCz11 21 28459815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AASATTTTTGGCTTCAGTTTTTTGAAGGTAAAGAGCTCCGACTGAAACAA[G/T]AGTACTTTGTAGTGGCTGCGACTCTCCAAGACATCATTCGTCGCTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39334
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077871 Essential Splice Site 657 842 17 20
Genomic Location (Zv9):
Chromosome 21 (position 27863255)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28432166
GRCz11 21 28468861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGAGTCATGCGATTGTGAAAAATATCCCTATGGTTGTCTTTTTCTCTCA[G/A]CGATCCCCGCGGCCGACCTGTCCGAGCAGATCTCCACAGCCGGCACAGAA
Associated Phenotype:
Not determined