Busch Lab

ZMP

ENSDARG00000055506

Ensembl ID:
ENSDARG00000055506

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37818 Nonsense Mutation detected in F1 DNA Not yet available
sa30033 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37818
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077866 Nonsense 20 233 2 5
Genomic Location (Zv9):
Chromosome 24 (position 6178820)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6066112
GRCz11 24 6095441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGCATGTACGGATTTTTACCCCTTAGATTTCACTTGCTGCAACCATG[G/T]AGGAGTTGTGTGAGGCAACAGAGTGTATGAGTGAATACCTGGCAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30033
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077866 Nonsense 28 233 2 5
Genomic Location (Zv9):
Chromosome 24 (position 6178794)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6066086
GRCz11 24 6095415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGATTTCACTTGCTGCAACCATGGAGGAGTTGTGTGAGGCAACAGAGTG[T/A]ATGAGTGAATACCTGGCAAATGCAGGATGCCTTCGAGCTGTAAAATGCCT
Associated Phenotype:
Not determined