Busch Lab

ZMP

atf7b

Ensembl ID:
ENSDARG00000055481
ZFIN ID:
ZDB-GENE-030131-3028
Description:
activating transcription factor 7b [Source:RefSeq peptide;Acc:NP_001020720]
Human Orthologue:
ATF7
Human Description:
activating transcription factor 7 [Source:HGNC Symbol;Acc:792]
Mouse Orthologue:
Atf7
Mouse Description:
activating transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:2443472]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26790
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077839 Nonsense 16 427 2 11
ENSDART00000104042 Nonsense 16 459 2 12
ENSDART00000136076 Nonsense 16 451 2 12
Genomic Location (Zv9):
Chromosome 6 (position 39561499)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39633099
GRCz11 6 39630635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAATGGGAGACGATCGACCTTTTGTCTGCACTGCCCCAGGTTGTGGA[C/T]AGGTAAGAGCTGTTTATTTTATCCTTACTGTTAAGGCAAGACACTGCAGG
Associated Phenotype:
Not determined