Busch Lab

ZMP

si:ch211-250g4.1

Ensembl ID:
ENSDARG00000055459
ZFIN ID:
ZDB-GENE-060503-413
Description:
disks large-associated protein 3 [Source:RefSeq peptide;Acc:NP_001038179]
Human Orthologue:
DLGAP3
Human Description:
discs, large (Drosophila) homolog-associated protein 3 [Source:HGNC Symbol;Acc:30368]
Mouse Orthologue:
Dlgap3
Mouse Description:
discs, large (Drosophila) homolog-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:3039563]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa23571 Nonsense Available for shipment Available now
sa13263 Nonsense Available for shipment Available now
sa7460 Missense Mutation detected in F1 DNA Not yet available
sa23572 Nonsense Available for shipment Available now
sa7461 Missense Mutation detected in F1 DNA Not yet available
sa43323 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23571
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 149 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39007951)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37871934
GRCz11 19 37459054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGCGGAGCGAGAGTCCAAGTCGCATACGGCATTTGGTAAACTCTGTC[C/T]AGCGTCTTTTCGCCAAGTCTCATTCTCTAGAAGCACCCTCTAAACGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 232 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008202)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872185
GRCz11 19 37459305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCGCCATGAGTCTCGAAGTTCCCGTMACCGCAGTAAAACAGCCGGCTG[G/A]TGGAGCTCTGATGACAACCTGGACAGCGACAGCAGCTTTCWGGTGGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Missense 246 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008243)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872226
GRCz11 19 37459346
KASP Assay ID:
554-4277.1 (used for ordering genotyping assays)
KASP Sequence:
AGCCGGCTGGTGGAGCTCTGATGACAACCTGGACAGCGACAGCAGCTTTC[T/A]GGTGGGTGCAGGCAGGGGTGTTCGAGGTTATCCCACCGGACACGAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23572
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 274 1059 1 10
Genomic Location (Zv9):
Chromosome 19 (position 39008326)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37872309
GRCz11 19 37459429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCGGACACGAGACCCTGGATGCTGCCATTCAGGAACTTACCTTAAGG[A/T]AATCTAAAGGTCCACCTCCTGGAGAGTGCTTGGCTTGCACCAATATAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7461
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Missense 421 1059 2 10
Genomic Location (Zv9):
Chromosome 19 (position 39026779)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37890762
GRCz11 19 37477882
KASP Assay ID:
554-4378.1 (used for ordering genotyping assays)
KASP Sequence:
CCCTCATTGCCCAGAGAGAAGCCTTCCGCCGCTCCGTCAGCATGGATCAA[C/T]GCTCCTCCACAACATCCAAGTCAGTCGTCAATTAATTTTAARTTTGTAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4071
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 493 1059 4 10
Genomic Location (Zv9):
Chromosome 19 (position 39030543)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37894526
GRCz11 19 37481646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGAGGCACTGGATCTACCTRGATGTTTCCGMACACGCAGTCACAGTTA[T/A]GTACRAGCAATCCAAGCCGGATGCTCCCAGGATGATGACTGCCTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29243
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Splice Site, Nonsense 727 1059 7 10
Genomic Location (Zv9):
Chromosome 19 (position 39037449)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37901432
GRCz11 19 37488552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATCAATCTGCTGGTAAGTTTAATGGTCATGTTGTTGTTTGTTCCAGA[C/T]GAGCACGTTTCAAACGCTCCAACAGCGTAACGGCAAGTGTCCAGGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43323
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103151 Nonsense 850 1059 7 10
Genomic Location (Zv9):
Chromosome 19 (position 39037818)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37901801
GRCz11 19 37488921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGAGGGCCCCCGGAGCCTCCCAGATTCAGGCCGAGCCTCGCCTTGCTTA[C/T]GAGATGGAGAGTTCTTCCTCCGGCTCCTGCAGACAGAGGTGGAGAGGATG
Associated Phenotype:
Not determined