Busch Lab

ZMP

ENSDARG00000055453

Ensembl ID:
ENSDARG00000055453

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15471 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15471
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077796 Essential Splice Site 231 259 5 5
Genomic Location (Zv9):
Chromosome 1 (position 40625639)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39515048
GRCz11 1 40233121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACTTWAACRTTAAAGTAATATTAAAATGTCTCCCCCATCTTCCTGTGC[A/T]GATTGCTGTCGTCTGCTACGGGAGCTCCTCAACCCCCATGATAGCGAGCG
Associated Phenotype:
Not determined