Busch Lab

ZMP

si:dkey-24f15.3

Ensembl ID:
ENSDARG00000055429
ZFIN ID:
ZDB-GENE-000607-52
Description:
Novel protein similar to vertebrate MYST histone acetyltransferase (Monocytic leukemia) 4 (MYST4) [S
Human Orthologue:
MYST4
Human Description:
MYST histone acetyltransferase (monocytic leukemia) 4 [Source:HGNC Symbol;Acc:17582]
Mouse Orthologue:
Myst4
Mouse Description:
MYST histone acetyltransferase monocytic leukemia 4 Gene [Source:MGI Symbol;Acc:MGI:1858746]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa14848 Nonsense Mutation detected in F1 DNA Not yet available
sa42204 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available
sa16535 Nonsense Available for shipment Available now
sa15696 Nonsense Available for shipment Available now
sa1676 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2732
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Nonsense 433 2043 6 16
ENSDART00000136624 None None 1368 None 10
ENSDART00000148191 Nonsense 433 646 6 6
Genomic Location (Zv9):
Chromosome 13 (position 25105802)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24751462
GRCz11 13 24881912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACCAAAGGTCTCATTGACGGGCTTTCCAAATTTTTCACGCCATCGCCCT[T/A]GGRTCGCCGGTTGCGCGGTGAAGCGTCGGGCTCCTCGAAKCAGCACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14848
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Nonsense 541 2043 6 16
ENSDART00000136624 None None 1368 None 10
ENSDART00000148191 Nonsense 541 646 6 6
Genomic Location (Zv9):
Chromosome 13 (position 25105479)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24751139
GRCz11 13 24881589
KASP Assay ID:
1641-0498.1 (used for ordering genotyping assays)
KASP Sequence:
AGCKWAAGGGACTCTTTGATGGACTGTCTCACATYTTTACCACTCAGGGA[C/T]AGTCCCGACAAAAGGGACTCCCCAGCTACGCACCACCCAAGCGAGTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Splice Site None 2043 None 16
ENSDART00000136624 Essential Splice Site 315 1368 8 10
ENSDART00000148191 None None 646 None 6
Genomic Location (Zv9):
Chromosome 13 (position 25098892)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24744552
GRCz11 13 24875002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTATTTAAAACAACTTAGACAAGCCCATGTTTGTGTTTGTTTGAAATA[G/A]CAGGCAAGGGACCATCGTGCAGACTATACTGCTTCAACCAGGAATTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16535
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Nonsense 1555 2043 16 16
ENSDART00000136624 Nonsense 880 1368 10 10
ENSDART00000148191 None None 646 None 6
Genomic Location (Zv9):
Chromosome 13 (position 25096407)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24742067
GRCz11 13 24872517
KASP Assay ID:
2260-6421.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGTAAGATCAGTTAACAGTCCAGCCGTGTCTATTTTAGAAAGTGGTTA[C/A]ACACAAATCAGCCCCGATCAGGGCACCKTTTCAGTGCACTCACTTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15696
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Nonsense 1829 2043 16 16
ENSDART00000136624 Nonsense 1154 1368 10 10
ENSDART00000148191 None None 646 None 6
Genomic Location (Zv9):
Chromosome 13 (position 25095586)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24741246
GRCz11 13 24871696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGCCTCACACTCCATCCCATCCTATGCAAACAACAAYGGCTCATTGT[C/A]AACGCAGCTTGGTCCTCATAATCCCACGCTGGTGTMGCTGTCACAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077775 Nonsense 1841 2043 16 16
ENSDART00000136624 Nonsense 1166 1368 10 10
ENSDART00000148191 None None 646 None 6
Genomic Location (Zv9):
Chromosome 13 (position 25095550)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24741210
GRCz11 13 24871660
KASP Assay ID:
554-1622.1 (used for ordering genotyping assays)
KASP Sequence:
CAACGGCTCATTGTCAACGCAGCTTGGTCCTCATAATCCCACGCTGGTGT[C/A]GCTGTCACAGCCCGGTGGAGGTCCTCAGTCGCAATCTACTGTGACCCCTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461