Busch Lab

ZMP

si:dkey-67c22.2

Ensembl ID:
ENSDARG00000055389
ZFIN ID:
ZDB-GENE-030131-5845
Description:
hypothetical protein LOC792544 [Source:RefSeq peptide;Acc:NP_001123872]
Human Orthologue:
SRRM5
Human Description:
serine/arginine repetitive matrix 5 [Source:HGNC Symbol;Acc:37248]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa34696 Nonsense Mutation detected in F1 DNA Not yet available
sa9800 Nonsense Available for shipment Available now
sa34697 Nonsense Mutation detected in F1 DNA Not yet available
sa2494 Nonsense Available for shipment Available now
sa13667 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1860
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 20 1069 2 7
ENSDART00000122057 Nonsense 20 1069 3 7
ENSDART00000122169 Splice Site None 229 None 5
ENSDART00000130549 Nonsense 20 1069 3 8
Genomic Location (Zv9):
Chromosome 9 (position 36888198)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36026087
GRCz11 9 35835272
KASP Assay ID:
554-1851.1 (used for ordering genotyping assays)
KASP Sequence:
AAAYATGTATCCTCAACAGAGGATGAGCCATCTGATACTGCTGTTCCATA[T/A]GAAGCCATGATTGTTAAAGATGGGAGCGAGACCCCAAAAAAGAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34696
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 238 1069 4 7
ENSDART00000122057 Nonsense 238 1069 5 7
ENSDART00000122169 Nonsense 226 229 5 5
ENSDART00000130549 Nonsense 238 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889090)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36026979
GRCz11 9 35836164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACATAAAAGTGGAACCTATTGATAAAGATGAAAGTTATGGTATAGCT[C/T]AAGCACTTCCCGATATTATTCCCAAACAAGAAAATGTGCAGAAGGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9800
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 481 1069 4 7
ENSDART00000122057 Nonsense 481 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 481 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889819)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36027708
GRCz11 9 35836893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTCATAGAAGATCAATTTCAAGAAGCCCAAGACGTCGAAGTAAATCT[C/T]GATCCCCCTAWCGCTCCAGGCCCTCTAAGTCACGTTCTCCTGCAGTCCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5785
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 484 1069 4 7
ENSDART00000122057 Nonsense 484 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 484 1069 5 8
ENSDART00000077740 Nonsense 484 1069 4 7
ENSDART00000122057 Nonsense 484 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 484 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889830)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36027719
GRCz11 9 35836904
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATCAATTTCAAGAAGCCCAAGACGTCGAAGTAAATCTCGATCCCCCTA[T/A]CGCTCCAGGCCCTCTAAGTCACGTTCTCCTGCAGTCCGTAAAAGGAAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3744
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 484 1069 4 7
ENSDART00000122057 Nonsense 484 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 484 1069 5 8
ENSDART00000077740 Nonsense 484 1069 4 7
ENSDART00000122057 Nonsense 484 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 484 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36889830)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36027719
GRCz11 9 35836904
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATCAATTTCAAGAAGCCCAAGACGTCGAAGTAAATCTCGATCCCCCTA[T/A]CGCTCCAGGCCCTCTAAGTCACGTTCTCCTGCAGTCCGTAAAAGGAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 597 1069 4 7
ENSDART00000122057 Nonsense 597 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 597 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890167)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028056
GRCz11 9 35837241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCATCTCCTGCTAAAGAAGACAAGTCTTTAAAGGATAAGAATTCAAAA[G/T]AAACCTCAGAAACCACACAGAAACTTTTGGTAGCCATAGAGGAAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 673 1069 4 7
ENSDART00000122057 Nonsense 673 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 673 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890396)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028285
GRCz11 9 35837470
KASP Assay ID:
554-2809.1 (used for ordering genotyping assays)
KASP Sequence:
GCCAGAGGATCCMTCTAAATGTGAAGAAAGACCTATCCGGTCCAGATCTT[T/A]GTCCTTAGATCCAGTTCCTCAACACGGTACAGMAGGGTCAGAAGAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13667
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077740 Nonsense 858 1069 4 7
ENSDART00000122057 Nonsense 858 1069 5 7
ENSDART00000122169 None None 229 None 5
ENSDART00000130549 Nonsense 858 1069 5 8
Genomic Location (Zv9):
Chromosome 9 (position 36890950)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36028839
GRCz11 9 35838024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGTCACGCCGGAGAAGACCAGCATTTAGAGGGCGATCATTTGACAGA[C/T]GAGATCGGTGGAAACGTGAACCAAGTCATTCCCCAATTTTAATTCTCCGC
Associated Phenotype:
Not determined