Busch Lab

ZMP

sema3fb

Ensembl ID:
ENSDARG00000055373
ZFIN ID:
ZDB-GENE-050513-2
Description:
Semaphorin 3Fb [Source:UniProtKB/TrEMBL;Acc:Q5ID23]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35134 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14466 Nonsense Available for shipment Available now
sa38853 Nonsense Mutation detected in F1 DNA Not yet available
sa24893 Nonsense Mutation detected in F1 DNA Not yet available
sa13129 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Essential Splice Site 37 787 1 18
ENSDART00000077717 None None 743 None 19
ENSDART00000139712 None None 688 None 16
Genomic Location (Zv9):
Chromosome 11 (position 36410388)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35307616
GRCz11 11 35569599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGGCAATGAACCTCAAAATGCCCCGCGGGTCTTCTTGTCCTTCAAAG[G/A]TAAGAGAGCATTCAGTTCTGGTTTCTCTTGGTTTGCTCTTGCGTTCCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3783
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Essential Splice Site 411 787 12 18
ENSDART00000077717 Essential Splice Site 363 743 13 19
ENSDART00000139712 Essential Splice Site 312 688 10 16
Genomic Location (Zv9):
Chromosome 11 (position 36305982)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35203210
GRCz11 11 35465193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTTTTTTTTTTTTTTTTACAATGGGTTTGTTTGCTTGTTTGTTTTTC[A/G]GTGTCCTGGTGGGACTTTCACCCCGAACATGAAGTCCACTAAGGACTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 477 787 12 18
ENSDART00000077717 Nonsense 429 743 13 19
ENSDART00000139712 Nonsense 378 688 10 16
Genomic Location (Zv9):
Chromosome 11 (position 36305780)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35203008
GRCz11 11 35464991
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTTCACAACCWTCACTGTGGATCAGGTCACAGCGGCCGACGGAAACTA[T/G]GAGGTGCTSTTCCTGGGAACAGGTGAGTTTCATGATTTTTTTTTNNNCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38853
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 532 787 15 18
ENSDART00000077717 Nonsense 484 743 16 19
ENSDART00000139712 Nonsense 433 688 13 16
Genomic Location (Zv9):
Chromosome 11 (position 36298413)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35195641
GRCz11 11 35457624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGTAATGTTTAAATAACTTTTTAAATTCTTTTTGCAGCAACAACTGTA[T/A]GTGGCCTCTGCGGTGGGAGTGACGCATATGGCTCTGCACCGCTGTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24893
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Nonsense 579 787 15 18
ENSDART00000077717 Nonsense 531 743 16 19
ENSDART00000139712 Nonsense 480 688 13 16
Genomic Location (Zv9):
Chromosome 11 (position 36298274)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35195502
GRCz11 11 35457485
KASP Assay ID:
554-7331.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCCTATTGTGCATGGGACGGCAAATCCTGCTCTAGATACTCAGCCTCG[C/T]AGAAGAGGTAAATATGCTAAAGCATGCAAATAATGTTCTTAACAAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031441 Essential Splice Site 649 787 None 18
ENSDART00000077717 Essential Splice Site 605 743 None 19
ENSDART00000139712 Essential Splice Site 550 688 None 16
Genomic Location (Zv9):
Chromosome 11 (position 36292783)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 35190011
GRCz11 11 35451994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGTGGCAATAATRCTWGTRAAAGTAATTGCTCCTGTGTGTGTTTGTGC[A/G]GRTCCGCAGTGATGGCCGTGTGCTGAAGWCGGATCAAGGTTTGCTTCTGC
Associated Phenotype:
Not determined