Busch Lab

ZMP

pknox2

Ensembl ID:
ENSDARG00000055349
ZFIN ID:
ZDB-GENE-031118-112
Description:
pbx/knotted 1 homeobox 2 [Source:RefSeq peptide;Acc:NP_705940]
Human Orthologue:
PKNOX2
Human Description:
PBX/knotted 1 homeobox 2 [Source:HGNC Symbol;Acc:16714]
Mouse Orthologue:
Pknox2
Mouse Description:
Pbx/knotted 1 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2445415]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17092 Essential Splice Site Available for shipment Available now
sa17850 Nonsense Available for shipment Available now
sa466 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27630
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Essential Splice Site None 474 None 11
ENSDART00000134866 Essential Splice Site None 474 None 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32117067)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31218416
GRCz11 10 31104756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATTTTACTCACTCTAAATAATATTTTATGTCACTGTTTTCTTTGCTTC[A/T]GGGTCTCCATGTGAAGCTATCCCATGATGCAACATGTGTCCCCAGCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17092
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Essential Splice Site 75 474 None 11
ENSDART00000134866 Essential Splice Site 75 474 None 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32079117)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31180466
GRCz11 10 31066806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTTGACCCTCAAGCCCAACTGGAGTCKGACAAACGAGCCGTTTACAGG[T/G]CAGTGCAACGGATATTTACWAARATTTCAAAACTTGTGCTCGAGTTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17850
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Nonsense 244 474 7 11
ENSDART00000134866 Nonsense 244 474 8 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32043860)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31145209
GRCz11 10 31031549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGTAAAGTGTGTGATAACCCGACTGATTCCCACAGGTGGGACGCTGTA[T/A]CAGCCRGTGGCAATGGTTACCTCACAGGGGCAGGTGTTAACACAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004553 Nonsense 292 474 8 11
ENSDART00000134866 Nonsense 292 474 9 12

The following transcripts of ENSDARG00000055349 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 32039468)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31140817
GRCz11 10 31027157
KASP Assay ID:
554-0198.1 (used for ordering genotyping assays)
KASP Sequence:
TGGACTTGTCCTCACTCTTGGATGGCGATGACAAGAAATCAAAAAACAAA[A/T]GAGGCGTCCTTCCCAAACATGCCACAAACATTATGCGTTCCTGGCTCTTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461