Busch Lab

ZMP

mipep

Ensembl ID:
ENSDARG00000055344
ZFIN ID:
ZDB-GENE-060503-662
Human Orthologue:
MIPEP
Human Description:
mitochondrial intermediate peptidase [Source:HGNC Symbol;Acc:7104]
Mouse Orthologue:
Mipep
Mouse Description:
mitochondrial intermediate peptidase Gene [Source:MGI Symbol;Acc:MGI:1917728]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa35809 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35809
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077660 Essential Splice Site 605 702 16 19
ENSDART00000142022 None None 98 None 3
Genomic Location (Zv9):
Chromosome 15 (position 8281828)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8231335
GRCz11 15 8207406
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAGACTTGCAGAAGAAGTATTATGGTCTGCCATATGTCGCCAACACAG[T/C]GAGTGTGCTTCATTTAAAATCATACATAAATATTTAATTGTATTCTTTAA
Associated Phenotype:
Not determined