Busch Lab

ZMP

si:ch211-216k22.8

Ensembl ID:
ENSDARG00000055331
ZFIN ID:
ZDB-GENE-081104-507
Description:
hypothetical protein LOC100006238 [Source:RefSeq peptide;Acc:NP_001119952]
Human Orthologue:
ALDH9A1
Human Description:
aldehyde dehydrogenase 9 family, member A1 [Source:HGNC Symbol;Acc:412]
Mouse Orthologue:
Aldh9a1
Mouse Description:
aldehyde dehydrogenase 9, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1861622]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34378 Essential Splice Site Available for shipment Available now
sa21267 Nonsense Available for shipment Available now
sa21266 Nonsense Available for shipment Available now
sa41181 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34378
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100281 Essential Splice Site 50 508 1 11
Genomic Location (Zv9):
Chromosome 8 (position 21629805)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21059702
GRCz11 8 21091787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGCCAAGTAACACGAAAAACTCCGAGCCAGTATACGAGCCTGCAACTG[G/A]TAGGATTGTTTACTACTTTAATTAATTACTTTAATATCTTTCTTGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21267
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100281 Nonsense 89 508 2 11
Genomic Location (Zv9):
Chromosome 8 (position 21629035)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21058932
GRCz11 8 21091017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATTCTGCATACCTAAAATGGAGTCAATTATCAGGAATGGAGAGGTCC[C/T]GAATCATGCTGGAGGCTGCCAGAATTATCAGGGTAAAAGCATATAATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21266
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100281 Nonsense 373 508 8 11
Genomic Location (Zv9):
Chromosome 8 (position 21625281)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21055178
GRCz11 8 21087263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAAGCATCATTGTTGTTTTAGGGTGCAAAGGTTTTATGTGGAGGAGAA[C/T]AATTTGTCCCCAATGATCCCAAACTGAAAGACGGATACTTTGTGTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41181
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100281 Essential Splice Site 478 508 10 11
Genomic Location (Zv9):
Chromosome 8 (position 21621906)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21051803
GRCz11 8 21083888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAATGTTTGTCCTGTGGAAGTTCCTTTTGGGGGCTACAAGATGTCAGG[T/C]ACTCCAAACATATGCACATTTATCTTTACTACACATTCACCTTTTTCTAA
Associated Phenotype:
Not determined