Busch Lab

ZMP

grid2

Ensembl ID:
ENSDARG00000055302
ZFIN ID:
ZDB-GENE-040913-1
Description:
Glutamate receptor delta-2 subunit [Source:UniProtKB/Swiss-Prot;Acc:Q68Y21]
Human Orthologue:
GRID2
Human Description:
glutamate receptor, ionotropic, delta 2 [Source:HGNC Symbol;Acc:4576]
Mouse Orthologue:
Grid2
Mouse Description:
glutamate receptor, ionotropic, delta 2 Gene [Source:MGI Symbol;Acc:MGI:95813]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa45326 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10692 Nonsense Available for shipment Available now
sa9218 Nonsense Mutation detected in F1 DNA Not yet available
sa18043 Essential Splice Site Available for shipment Available now
sa30640 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18921
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location (Zv9):
Chromosome 8 (position 30115407)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29258133
GRCz11 8 29267365
KASP Assay ID:
2260-0742.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTCCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCATTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8370
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location (Zv9):
Chromosome 8 (position 30115407)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29258133
GRCz11 8 29267365
KASP Assay ID:
2260-0742.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTTSCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCRTTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2468
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
ENSDART00000077647 Nonsense 91 928 1 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 172 1009 3 16
Genomic Location (Zv9):
Chromosome 8 (position 30115407)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29258133
GRCz11 8 29267365
KASP Assay ID:
2260-0742.1 (used for ordering genotyping assays)
KASP Sequence:
ATCTTSCAAGTGGTGATGGAGTACACTTGGCAGAAGTTCRTTATCTTCTA[T/A]GACACAGACTATGGTGAGTAGTTTCAATTTACTGATGGCTGTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45326
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Essential Splice Site 164 928 2 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Essential Splice Site 245 1009 4 16
Genomic Location (Zv9):
Chromosome 8 (position 30133714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29276440
GRCz11 8 29285672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGCTGTTCATGAGTCCCGCCACTGCCAAGGCCTTCATTACCGAGG[T/C]ACATTCACATACACAAGCTAGTATGAACATATATCACACACCAGCCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10692
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 620 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 701 1009 13 16
Genomic Location (Zv9):
Chromosome 8 (position 30339981)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29482707
GRCz11 8 29491939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCTGCCGTCTATGACCAGGTTCGCAGTAAAGGAATGAACCCTTTCGAA[C/T]GAGACCCGATGTAWTCGCAGATGTGGCGGATGATCAACCGGACAGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9218
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Nonsense 624 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Nonsense 705 1009 13 16
Genomic Location (Zv9):
Chromosome 8 (position 30339995)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29482721
GRCz11 8 29491953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCAGGTTCGCAGTAAAGGAATGAACCCTTTCGAAYGAGACCCGATGTA[T/A]TCGCAGATGTGGCGGATGATCAACCGGACAGGAGGAGCCGAAAACAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18043
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Essential Splice Site 650 928 11 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Essential Splice Site 731 1009 13 16
Genomic Location (Zv9):
Chromosome 8 (position 30340074)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29482800
GRCz11 8 29492032
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAGGAGCCGAAAACAACGTGGAGGAATCAAAAGAAGGCATCCGGARG[G/T]TAGGAGGCTYTAGCCGCTTTGACTACYGCCACCGTTTGTCTARTWACGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30640
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077647 Essential Splice Site 786 928 13 14
ENSDART00000127112 None None 51 None 1
ENSDART00000141634 Essential Splice Site 867 1009 15 16
Genomic Location (Zv9):
Chromosome 8 (position 30423109)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29565835
GRCz11 8 29575067
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGACCTGGTGGACACGAAGAAAGGGCTCCAGAGTCCCATCGAAGGAG[G/A]TGAGAGTCGATCATAAACCTCTGTCATAAACACAATAGTGGCACACGATT
Associated Phenotype:
Not determined