Busch Lab

ZMP

cfb

Ensembl ID:
ENSDARG00000055278
ZFIN ID:
ZDB-GENE-980526-487
Description:
complement factor B [Source:RefSeq peptide;Acc:NP_571413]
Human Orthologues:
CFB, XXbac-BPG116M5.17
Human Descriptions:
cDNA FLJ55673, highly similar to Complement factor B [Source:UniProtKB/TrEMBL;Acc:B4E1Z4]
complement factor B [Source:HGNC Symbol;Acc:1037]
Mouse Orthologue:
Cfb
Mouse Description:
complement factor B Gene [Source:MGI Symbol;Acc:MGI:105975]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23958 Essential Splice Site Available for shipment Available now
sa14271 Nonsense Available for shipment Available now
sa29609 Nonsense Mutation detected in F1 DNA Not yet available
sa1866 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa23958
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Essential Splice Site 91 761 2 18
ENSDART00000108763 Essential Splice Site 91 759 2 20
Genomic Location (Zv9):
Chromosome 21 (position 26811085)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27379996
GRCz11 21 27416691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTCTGGACCCCAAAGGCCAGCTCTAGAAAAAAAGCTGAGTGCAAAA[G/A]TAAGAAATAGAGCTTCACTTTGTATCATTATATCATGAATAAATGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14271
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Nonsense 311 761 7 18
ENSDART00000108763 Nonsense 311 759 7 20
Genomic Location (Zv9):
Chromosome 21 (position 26812518)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27381429
GRCz11 21 27418124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCRAACTATGAGATCYTGATGTTTGCRACGGATGTTGATCAGATAGTT[A/T]AAATGAGGGATTTCAAAACTAATGAAAAGGCAAGAAAMATCTYGAAGRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29609
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Nonsense 473 761 11 18
ENSDART00000108763 Nonsense 473 759 11 20
Genomic Location (Zv9):
Chromosome 21 (position 26820701)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27389612
GRCz11 21 27426307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACACAGATGATAGCACCGTTGTAGGATTGTGTGGGATGCAGCAAAACTA[T/G]GATGGATCAAATAAACGCAGCGCATACCCCTGGTTGGCACAGCTTAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1866
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077593 Nonsense 509 761 12 18
ENSDART00000108763 Nonsense 509 759 12 20
Genomic Location (Zv9):
Chromosome 21 (position 26820949)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27389860
GRCz11 21 27426555
KASP Assay ID:
554-1857.1 (used for ordering genotyping assays)
KASP Sequence:
ATCGCAGATCTCAGATTGCATGGGCTCGTTAGTTACCTCCCGGTATATCT[T/A]GACAGCAGCCCACTGTTTTAAAGAAGGAGACACACCKGATAAGATAACRG
Associated Phenotype:
Not determined