Busch Lab

ZMP

xdh

Ensembl ID:
ENSDARG00000055240
ZFIN ID:
ZDB-GENE-070719-9
Human Orthologue:
XDH
Human Description:
xanthine dehydrogenase [Source:HGNC Symbol;Acc:12805]
Mouse Orthologue:
Xdh
Mouse Description:
xanthine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:98973]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa12706 Essential Splice Site Available for shipment Available now
sa23125 Nonsense Available for shipment Available now
sa42968 Nonsense Mutation detected in F1 DNA Not yet available
sa5632 Nonsense F2 line generated Not yet available
sa14557 Nonsense Available for shipment Available now
sa36464 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42969 Nonsense Mutation detected in F1 DNA Not yet available
sa9542 Nonsense Available for shipment Available now
sa36465 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7834
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 27 1351 1 36
Genomic Location (Zv9):
Chromosome 17 (position 33546712)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33388443
GRCz11 17 33340954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTCAGTCTCCAGGGGATGACCTTGTCTTCTTCGTTAATGGAAAAAAGG[T/A]AAGGGGGGATTGAATAAGCATATTACATATCTCCAAGTGTTTCATAAATT
Long Flanking Sequence:
CAAAATATTTTTTGCCCAAAGCCAAAGCTGTTCACACAAGAAAAACTGCTTTATTGACAGAAAAAACAGCATGTAGGCTACAATACTTTCTTTAAATGACATAATATTGTACAGCGCTTATAAAACATTTTGTTAAAAACGTATTTTTTTCTGTAACTCCAGTTCTAAAGTCCAGTGCTCAAGTGTCTATTCTTCAAAACAATTTCAACGCAATCAATTTTCCTGTCTACTCGTAAGCATGAATCAAAGGTTTTGTGTACTAACCATCGCTAAAGTCATTCTCCACACAGCAGCTCTTCCAGCGTGAGTTGATAAGAATCGGGTCACGTGACGCAGTGGCTCTCATAGTTCGTCCGTTCACTGTCGTCGGCGCTTTATCTCATCTCACCGATCAACCGGCGAACAGCGGGAATTAAACATGTCCATCAGCGAGGATAAGATTAAAAACAAACTTCAGTCTCCAGGGGATGACCTTGTCTTCTTCGTTAATGGAAAAAAGG[T/A]AAGGGGGGATTGAATAAGCATATTACATATCTCCAAGTGTTTCATAAATTCTTCCATTTTTTTATTAAAGTTTTTATAGTTCAGAGTCTTTTCGTAATTCATTTTGTGCAGATCACTGAGAAGAATGCAGACCCTGAAATAACACTCTTGACTTATCTTAGAAGAAGCTGTATCCTTTTGATATTTTGTTCAGTGTCTGAATGCCTTTTTATTCATTCTGCAATGTTGTAGGCTAATGTGAAACCATAACACTAGCTTTTATGAGACACTGGTATTCCTGTTTCTGCAATATTGTGGTTGATAGTTTGCTGTTTTCTGGGTCTCCTGGGTTTCTTGATGTTTGCTAGAGTGTCACTGTACATATTAATATTATATTTGAATGATTATTATCTAATAGTTTAGTCAGCACTTTTATTTTGCTGTTACGTCTGCTGTTTTTCTGTGTGACTGGCCTTTATTTAATATTTTCTCTTCAATTAAAAATTTGTCTAAGCATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12706
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 234 1351 8 36
Genomic Location (Zv9):
Chromosome 17 (position 33552869)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33394600
GRCz11 17 33347111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCCACTGGACCCGACACAAGAGATTATTTTTCCACCTGAGCTTGTGG[T/A]GCRTATAAGAAGTTTAATTTKCATATTGGACYRTCATAGTAAACACAKCT
Long Flanking Sequence:
TGGCTGCTGTATGACTAATGGAAACACACAAGAGCATGTTAGTATGAGGAGAACATACATGCAAATACTAGGCTTGATTTTCTCAAACCAAGTACAAACACATTTTTGTCCTGAACTCGTCCATTCACAATAAACCTGCACCATCCTCGGGTAGGAAATCAATGACATGGCAGCCATTGCATATTTGTAGGAAACCAGTCACATGCTTAAAGCAACACTCATGAGCGTGTGAGGTCAAATCTACAGTAAAACCATGAAACGAACAGTAGAAACTTCTGGATCACTGTTTTGCAATCACATTACTTAATGTCATCTAAGGATATTTCATCTTCAATAAATAAATATTTTATTGAGACATCTAGATTTTAGTTCTTCAAAAATAACTTTTTCTTTCTATTTTTAGGAAAATTCAGCACATCCAGTTCAGCACTTGTATGACCAATCAGAGTTTATGCCACTGGACCCGACACAAGAGATTATTTTTCCACCTGAGCTTGTGG[T/A]GCGTATAAGAAGTTTAATTTTCATATTGGACTATCATAGTAAACACATCTATATTTGTATCTTTTACATCTATATTTGTTCTCTGCAGAGTCTGAGTAAACAGACCCAAAGAGAGATGAGGTTCGTTGGGGAGCGAGTGCTTTGGATTCAACCCTGCTCCCTCAAGGAGCTTCTGGAGCTGAAGGCCACATATCCAAATGCCAAACTAGTCGTTGGGAACACAGAAGTTGGTGAGGCCCACTTACATTGGAATTACATTTGAACTTAGCCTCATTTTCCATGTCTCCTAGAGTTGAACAGTTGATTTTTACCATTTGTTAATCTATTCAGCCAAGCTCTGGATCTGGCAGGAGCACTTTTAGCTTAGCTTAGCATAAACTATTGAATCTGATTAGACCATTAGCATCTCACTTAAAACATTTTTTAAATAATTTTCCTATTTAAAGCTTGACTCTTCTGTTTTGATACATTGTGTACTAAGACAGACAGAAAATGAAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1512
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 360 1351 11 36
Genomic Location (Zv9):
Chromosome 17 (position 33555072)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33396803
GRCz11 17 33349314
KASP Assay ID:
554-1436.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTTAAGGCTGTTCTAGAGCAGCTGCGCTGGTTTGCAGGACAGCAGATC[C/T]GAAATGTTGCAGTATGTTGTTCCTGTAAACAAAAAGTGACACAAAGAGCT
Long Flanking Sequence:
ATGGGTGGGCAAACTCGGTCCTGGAGTGCCGGTGTCCTGCACAGTTTAGCTACATCTCTAATCAAACACAACTGAACATGCTAATCAGCGTCTTCGAGATCACTAGAAATCTATAAACAGGCGTGTTTGATTAGAGTTGGAGCTAAAGTGTGTAGGACACCGGCCCTCCAGGACCGAGTTTGCCCACCCCTGATCTAGTCAGAATCTTACTAGACCTAACTTCCAGGCAAGGTTGTTGAAATTAAACAGCATAGGATATTGGACCTCCAGGAGAAGGATCTGACACCTATGGTCTAGTCTTTCGATGGCATTCACTATTTAGTGCGATTAATATTTACTATTTAATCTTCTCTATCTCAGGTATTGAGGTTGGCGCATCAGTGACGTTGACTGTGCTGGGGGATGTCCTGCAGTCAGCTGTGAAGAAGTTGCCCGCTTATCAAACTGAGGTTTTTAAGGCTGTTCTAGAGCAGCTGCGCTGGTTTGCAGGACAGCAGATC[C/T]GAAATGTTGCAGTATGTTGTTCCTGTAAACAAAAAGTGACACAAAGAGCTTTATATAATTGAATAGACTTGAAAATTACTGCCAGTTAATAACATAACAGTTAATAACATCCACAGAAAATATAAGTTATTATAAATATATTTACACATTATACATTTCAGCTATTTAATGTATTCTTGCTTTCAGGCTGTTGGTGGAAATATTATGACGGCAAGTCCCATTTCAGACCTCAACCCTGTGTTTATGGCAGCTGGCTGCAAGCTAACAGTGATGTCCAAAGGTACAGAACCCTGTTTTTATTTAGCTCAAGGATCAAAGGTTGTAGCAATGCACAGTGTAATACAGAATACAGAGCCAGTTTATGTGGAAAATCTCTAGAATTATCTGATTCCGTACTGTGCACTGATTTTACGAATAGTGCTGTTGTAGTCTGAATGTTATGATGGTTATTGCTAATAGGTTTAAAACAAATTAGCAACGCTAACTATACAGTTAGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23125
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 410 1351 13 36
Genomic Location (Zv9):
Chromosome 17 (position 33555902)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33397633
GRCz11 17 33350144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGGGAGAAACGAGTTCTTGAAATGGATGACAAGTTCTTCACTGGTTA[T/A]CGTAAGACTGCTTTGAAGCCAGAGGAGATTCTTTTGTCCATTGAGATTCC
Long Flanking Sequence:
GCACAGTGTAATACAGAATACAGAGCCAGTTTATGTGGAAAATCTCTAGAATTATCTGATTCCGTACTGTGCACTGATTTTACGAATAGTGCTGTTGTAGTCTGAATGTTATGATGGTTATTGCTAATAGGTTTAAAACAAATTAGCAACGCTAACTATACAGTTAGAAGTTCCCCGGTGTTTTTTAGCCAAATGGATGATTATGTTACATAGGGTAAGGGTTAAGGATACTGAAAGCTGTGGTAAACAGGACTTTCACAGCACATATTAGCCTAGTAGCATATACTGTAGGGTGTTGACCCAAAGTGTTTTGTTGATACTCCAGGTTTCCATGGGATTTTTTTTTTTTTTTTTTGTTTTCTTGTTCTGTAGATGTTACGATAGCAGAGAGCCATTTTATATCAATTAAACCTCTATTGTATATTCTATACAAATATATGTTTGATGTTTAAAGGGGAGAAACGAGTTCTTGAAATGGATGACAAGTTCTTCACTGGTTA[T/A]CGTAAGACTGCTTTGAAGCCAGAGGAGATTCTTTTGTCCATTGAGATTCCATACACAAAAAAGGTCTGTATATCCATTTAAAACACATTTTGTAGTTGAACTTATCCCAGATAATAACTTTGTCATCCAAAGCCATATGATGTTCTGTCATGTGTTGAATAAAAGGATCTATAAAAATCGATTGATTACACACATCCATATAATGAAACTTAATATCAGTCTGGGTTGTCAATGCCATAGTCATAGCTAATTGTGTGAGAGAGCAAAATATTAATTAGTACTTCATCTCATGAGTGTCTCTGTGTACCACTGAACAACATCATTCTGGATGGAAACAGCATGGTTATTAAATATTACTTTTCATTCAGTCTGATCAATTGGTTTTTTAGGGCCAGTACTTCTCAGCCTTCAAGCAATCCCCTCGCAAAGAGGATGATATCTCTATTGTCACGTGTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 470 1351 14 36
Genomic Location (Zv9):
Chromosome 17 (position 33556406)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33398137
GRCz11 17 33350648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGTATC[C/T]GAATAAGCTATGGAGGAATGGCCCCTGTCACTGTTCTTGCTACGGCCACA
Long Flanking Sequence:
AAGACTGCTTTGAAGCCAGAGGAGATTCTTTTGTCCATTGAGATTCCATACACAAAAAAGGTCTGTATATCCATTTAAAACACATTTTGTAGTTGAACTTATCCCAGATAATAACTTTGTCATCCAAAGCCATATGATGTTCTGTCATGTGTTGAATAAAAGGATCTATAAAAATCGATTGATTACACACATCCATATAATGAAACTTAATATCAGTCTGGGTTGTCAATGCCATAGTCATAGCTAATTGTGTGAGAGAGCAAAATATTAATTAGTACTTCATCTCATGAGTGTCTCTGTGTACCACTGAACAACATCATTCTGGATGGAAACAGCATGGTTATTAAATATTACTTTTCATTCAGTCTGATCAATTGGTTTTTTAGGGCCAGTACTTCTCAGCCTTCAAGCAATCCCCTCGCAAAGAGGATGATATCTCTATTGTCACGTGTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGTATC[C/T]GAATAAGCTATGGAGGAATGGCCCCTGTCACTGTTCTTGCTACGGCCACATGCAACAAGTTGCTTAACAGGTAAATGATGATGTCCAGCTTTCTCATTTTCATGTTTGACTGATGAGCTGAAGGAATGGATCAGCTTCACAAAAATCTTTATTTGAGTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCATTGGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACATACAGGCGCACATTGACTATCAGCCTCTTCTACAAATTCTTCCTCACTGTCCAGCACAAACTGGCTGTGAGCCTGCAGATGGAGGTTTTTAATTCTGATTACACGTTCAAGATTTTTTAAAAAGTGTACACTCTTCCAAGATAGAAAACATCGGTTCTACTCCTAATTACTTAACTGTCAATGACTATTTGTCATTTTTATATATATATATTTAAAGGGTGTTACCGTTGAAGACATCCAACCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5632
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 507 1351 15 36
ENSDART00000077553 Nonsense 507 1351 15 36
Genomic Location (Zv9):
Chromosome 17 (position 33556610)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33398341
GRCz11 17 33350852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAKTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACAT
Long Flanking Sequence:
ACTTAATATCAGTCTGGGTTGTCAATGCCATAGTCATAGCTAATTGTGTGAGAGAGCAAAATATTAATTAGTACTTCATCTCATGAGTGTCTCTGTGTACCACTGAACAACATCATTCTGGATGGAAACAGCATGGTTATTAAATATTACTTTTCATTCAGTCTGATCAATTGGTTTTTTAGGGCCAGTACTTCTCAGCCTTCAAGCAATCCCCTCGCAAAGAGGATGATATCTCTATTGTCACGTGTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGTATCCGAATAAGCTATGGAGGAATGGCCCCTGTCACTGTTCTTGCTACGGCCACATGCAACAAGTTGCTTAACAGGTAAATGATGATGTCCAGCTTTCTCATTTTCATGTTTGACTGATGAGCTGAAGGAATGGATCAGCTTCACAAAAATCTTTATTTGAGTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACATACAGGCGCACATTGACTATCAGCCTCTTCTACAAATTCTTCCTCACTGTCCAGCACAAACTGGCTGTGAGCCTGCAGATGGAGGTTTTTAATTCTGATTACACGTTCAAGATTTTTTAAAAAGTGTACACTCTTCCAAGATAGAAAACATCGGTTCTACTCCTAATTACTTAACTGTCAATGACTATTTGTCATTTTTATATATATATATTTAAAGGGTGTTACCGTTGAAGACATCCAACCTGAGTTTTCCACTGCTACTGAACTCTTCCAAGTGGACACACCATCCAGTGTACAGCTTTATCAGGTTAACATAATTGCACATGCAGCAGTTATTATTTAATTAGCAATTATCAATTAATGGTATGTGTTGACAAATTGCTTAACTTTGTTTGTTTGTAGGAAGTTCCTCCAGGTCAAAATGAGGATGATGTTGTGGGGCACCCTATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2937
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 507 1351 15 36
ENSDART00000077553 Nonsense 507 1351 15 36
Genomic Location (Zv9):
Chromosome 17 (position 33556610)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33398341
GRCz11 17 33350852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAKTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACAT
Long Flanking Sequence:
ACTTAATATCAGTCTGGGTTGTCAATGCCATAGTCATAGCTAATTGTGTGAGAGAGCAAAATATTAATTAGTACTTCATCTCATGAGTGTCTCTGTGTACCACTGAACAACATCATTCTGGATGGAAACAGCATGGTTATTAAATATTACTTTTCATTCAGTCTGATCAATTGGTTTTTTAGGGCCAGTACTTCTCAGCCTTCAAGCAATCCCCTCGCAAAGAGGATGATATCTCTATTGTCACGTGTGGGATGAATGTATATTTCAAGGAGCAATCCAATACAGTACAGAGTATCCGAATAAGCTATGGAGGAATGGCCCCTGTCACTGTTCTTGCTACGGCCACATGCAACAAGTTGCTTAACAGGTAAATGATGATGTCCAGCTTTCTCATTTTCATGTTTGACTGATGAGCTGAAGGAATGGATCAGCTTCACAAAAATCTTTATTTGAGTGCAGGCAATGGAATGAAGATCTTCTTGAGGAAGCCTGCAGCTCAT[T/A]GGCTGAGGAGATGAGTCTATCTCCCTCAGCTCCGGGTGGGATGGTGACATACAGGCGCACATTGACTATCAGCCTCTTCTACAAATTCTTCCTCACTGTCCAGCACAAACTGGCTGTGAGCCTGCAGATGGAGGTTTTTAATTCTGATTACACGTTCAAGATTTTTTAAAAAGTGTACACTCTTCCAAGATAGAAAACATCGGTTCTACTCCTAATTACTTAACTGTCAATGACTATTTGTCATTTTTATATATATATATTTAAAGGGTGTTACCGTTGAAGACATCCAACCTGAGTTTTCCACTGCTACTGAACTCTTCCAAGTGGACACACCATCCAGTGTACAGCTTTATCAGGTTAACATAATTGCACATGCAGCAGTTATTATTTAATTAGCAATTATCAATTAATGGTATGTGTTGACAAATTGCTTAACTTTGTTTGTTTGTAGGAAGTTCCTCCAGGTCAAAATGAGGATGATGTTGTGGGGCACCCTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14557
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 763 1351 21 36
Genomic Location (Zv9):
Chromosome 17 (position 33564752)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33406483
GRCz11 17 33358994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNNNNNNNNNNNNATTCTATAGGTGAGATGCACATTGGAGGGCAGGAA[C/T]AGTTTTATCTGGAGACTAACTGCACRCTGGCTGTCCCTCGTGGAGAGGAT
Long Flanking Sequence:
TCTGACCTTTCACCCTTGCTTAGTGGTTTTTCTGCTTTCATTATTGCATAACCAGATTTTTCAAGGTTTTCAGGGAAATGGCTTATAGTTCACAAATACATAACACATGGAGAGATAAGCTTGTCTGCTTTGCTAACTGTTTGCGTTCACTCTTTCAAACAGGATGCTATTAACAACAAGTCATTCTTCGAGCCAGTTAGAACTATAGAAAAAGGAGATGTTGCACAAGGATTTAAAGACTCTGATCACATCCTGCACGGTATTTATACATCTATATTTTATTCCAAATCATAACGATACACTGCATTCTTCTGAAAAACATATACCTAATAAATAGATTACACATTATGTTTATTGATGAAACAGTATGTCAATCAATGGTAGATCTGCAGTTTTCTCTGCCACCATTTGTATCACGGTCAGACCTGCTTCTCTTTAATTTGATGAGTTGATCTTAAATATGTAATTCTATAGGTGAGATGCACATTGGAGGGCAGGAA[C/T]AGTTTTATCTGGAGACTAACTGCACGCTGGCTGTCCCTCGTGGAGAGGATGGAGAAATGGAGCTGTTTGTGTCCACACAGTCGGCCTCCAAGACACAAGTAAATACACAAAACATTCAGTCTTTTAGGATTTAGTGTAGGATAGTAATTCCGATCCACATCAATACAATCATAGAATCAAAACAGAGAGATCCCAGCAGGCAGACAACATCATAAGACGTGTAATATTAGGTTAGATTTTGGTCATGATGTTAGGTGACTAAGCCGGATGATATTGGTTATCTAATTTTAAAATAGTATTAATGCAAAATATAACGTTGATTGCACTGTCCTGATGCACATGTTCTGCTGTGTTTGGCCCAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTGTCGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCACCATTCTATCCACTGTGGTTGCTGTTGCCGCACAAAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36464
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Essential Splice Site 795 1351 21 36
Genomic Location (Zv9):
Chromosome 17 (position 33564852)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33406583
GRCz11 17 33359094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGAAATGGAGCTGTTTGTGTCCACACAGTCGGCCTCCAAGACACAAG[T/A]AAATACACAAAACATTCAGTCTTTTAGGATTTAGTGTAGGATAGTAATTC
Long Flanking Sequence:
TAACACATGGAGAGATAAGCTTGTCTGCTTTGCTAACTGTTTGCGTTCACTCTTTCAAACAGGATGCTATTAACAACAAGTCATTCTTCGAGCCAGTTAGAACTATAGAAAAAGGAGATGTTGCACAAGGATTTAAAGACTCTGATCACATCCTGCACGGTATTTATACATCTATATTTTATTCCAAATCATAACGATACACTGCATTCTTCTGAAAAACATATACCTAATAAATAGATTACACATTATGTTTATTGATGAAACAGTATGTCAATCAATGGTAGATCTGCAGTTTTCTCTGCCACCATTTGTATCACGGTCAGACCTGCTTCTCTTTAATTTGATGAGTTGATCTTAAATATGTAATTCTATAGGTGAGATGCACATTGGAGGGCAGGAACAGTTTTATCTGGAGACTAACTGCACGCTGGCTGTCCCTCGTGGAGAGGATGGAGAAATGGAGCTGTTTGTGTCCACACAGTCGGCCTCCAAGACACAAG[T/A]AAATACACAAAACATTCAGTCTTTTAGGATTTAGTGTAGGATAGTAATTCCGATCCACATCAATACAATCATAGAATCAAAACAGAGAGATCCCAGCAGGCAGACAACATCATAAGACGTGTAATATTAGGTTAGATTTTGGTCATGATGTTAGGTGACTAAGCCGGATGATATTGGTTATCTAATTTTAAAATAGTATTAATGCAAAATATAACGTTGATTGCACTGTCCTGATGCACATGTTCTGCTGTGTTTGGCCCAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTGTCGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCACCATTCTATCCACTGTGGTTGCTGTTGCCGCACAAAAGTAAAATTTCACAAATAAATATTCATTTAATGTTGAGGATGAACTTTAAGTGTAGGTTAAACATACTGTTTTATGTTTTTCCTTTAGGGTTAAGTGCCCGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42969
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 811 1351 22 36
Genomic Location (Zv9):
Chromosome 17 (position 33565162)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33406893
GRCz11 17 33359404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTG[T/A]CGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCAC
Long Flanking Sequence:
GTATCACGGTCAGACCTGCTTCTCTTTAATTTGATGAGTTGATCTTAAATATGTAATTCTATAGGTGAGATGCACATTGGAGGGCAGGAACAGTTTTATCTGGAGACTAACTGCACGCTGGCTGTCCCTCGTGGAGAGGATGGAGAAATGGAGCTGTTTGTGTCCACACAGTCGGCCTCCAAGACACAAGTAAATACACAAAACATTCAGTCTTTTAGGATTTAGTGTAGGATAGTAATTCCGATCCACATCAATACAATCATAGAATCAAAACAGAGAGATCCCAGCAGGCAGACAACATCATAAGACGTGTAATATTAGGTTAGATTTTGGTCATGATGTTAGGTGACTAAGCCGGATGATATTGGTTATCTAATTTTAAAATAGTATTAATGCAAAATATAACGTTGATTGCACTGTCCTGATGCACATGTTCTGCTGTGTTTGGCCCAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTG[T/A]CGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCACCATTCTATCCACTGTGGTTGCTGTTGCCGCACAAAAGTAAAATTTCACAAATAAATATTCATTTAATGTTGAGGATGAACTTTAAGTGTAGGTTAAACATACTGTTTTATGTTTTTCCTTTAGGGTTAAGTGCCCGGTTCGCTGCATGTTAGATCGTGATGAGGACATGCTGGTCACAGGTGGCCGCCATCCTTTCTTTGGACAGTACAAGGTAAAAGTATATACAAGTTAACCAGATATTGTCCTTGTCCTGATTGGACTTTAATGAAGCTCTTTTGCTTTGTAACATCATGTTTAGGTGGGTTTTATGAAGAATGGAAGAGTGATGGCACTTGAGGTGACGCTCTACAGCAATGCAGGCAATTCACTGGACCTGTCATTGTCAGTGAGTGCTTTTGAATGTCCTAAAAGTTTTAAACGTCTGACACCCCCCCTAGTGGTCAATAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 868 1351 23 36
Genomic Location (Zv9):
Chromosome 17 (position 33565420)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33407151
GRCz11 17 33359662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGAGGACWTGCTGGTCACAGGTGGCCGCCATCCTTTCTTTGGACAGTA[C/A]AAGGTAAAAGTATATACAAGTTAACCAGATAYTGTCCWTGTCCTGATTGG
Long Flanking Sequence:
ATCATAGAATCAAAACAGAGAGATCCCAGCAGGCAGACAACATCATAAGACGTGTAATATTAGGTTAGATTTTGGTCATGATGTTAGGTGACTAAGCCGGATGATATTGGTTATCTAATTTTAAAATAGTATTAATGCAAAATATAACGTTGATTGCACTGTCCTGATGCACATGTTCTGCTGTGTTTGGCCCAGGCTCTGGTGGCTAAAGCTTTAGGTGTTCCTGCTAATCGGGTGGTGTGTCGTGTGAAGAGAATGGGTGGAGGATTTGGAGGGAAAGAGAGTCGGAGCACCATTCTATCCACTGTGGTTGCTGTTGCCGCACAAAAGTAAAATTTCACAAATAAATATTCATTTAATGTTGAGGATGAACTTTAAGTGTAGGTTAAACATACTGTTTTATGTTTTTCCTTTAGGGTTAAGTGCCCGGTTCGCTGCATGTTAGATCGTGATGAGGACATGCTGGTCACAGGTGGCCGCCATCCTTTCTTTGGACAGTA[C/A]AAGGTAAAAGTATATACAAGTTAACCAGATATTGTCCTTGTCCTGATTGGACTTTAATGAAGCTCTTTTGCTTTGTAACATCATGTTTAGGTGGGTTTTATGAAGAATGGAAGAGTGATGGCACTTGAGGTGACGCTCTACAGCAATGCAGGCAATTCACTGGACCTGTCATTGTCAGTGAGTGCTTTTGAATGTCCTAAAAGTTTTAAACGTCTGACACCCCCCCTAGTGGTCAATAAGACTCATTACATATTCCCACTAACCCTGCTGACCCACAGTGGTGTAAAAGAGTTTAAGCATATTTCAAAAATTATGTATTCCAAAGCAAATACATATATATATACATATATATATATAAATGTTTATATATATATATATATATATATATATATATATATATATATATATATATATTAATACTTAAAGCATAGGTCTCCAACTGGATTCCTGAAGGGCCGCAGCTCTGCACAGTTTTGCTCCAATCCTAATCAAACATAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4011
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 911 1351 25 36
Genomic Location (Zv9):
Chromosome 17 (position 33567913)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33409644
GRCz11 17 33362155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAATACACAGATCCTGGAGAGGGCGCTGTTYCACATGGATAACTCCTA[C/A]AACATTCCTAACATTTGTGGCACAGGCTACATGTGTAAAACCAACCTGCC
Long Flanking Sequence:
AAAAAAAACAAAACACAAAAAACAAAAAAACAAAGAAGAATACATTATTTCTGGGGGAAAAAATAAAAGTTTATAAATAGTCCTCTAATTAAGTTCTCAGCTACTGTGGCCCTTGCTGTTAGAATCAGCTTCCAGAAATGATCAGATGTGCTCCAACAATATGCACATTCAAATCAAGACTTAAAACACATCTGTTTAACTGTGACTTTACTGAATGAGCATTGGCAGATCACACTATAGTCTTTCTTTACTTCTTTATTTCCTGTATTTACACATTTTATTCTGTTGTTAATATTTTTTGTTGTTTTTGTTTGTTATAAATATATTTTATGTTTCTTTTATTCTTGTTTATGTAAAGCTCTTTGAATACGATTGTGTATGAATCGTGTTATATAAATAAATTTGCATTTGTCTTGCCTGTGGTCTCCACTGTAAACATCAGTTGTGTTTCTCAATACACAGATCCTGGAGAGGGCGCTGTTCCACATGGATAACTCCTA[C/A]AACATTCCTAACATTTGTGGCACAGGCTACATGTGTAAAACCAACCTGCCGTCTAATTCTGCATTCAGAGGCTTTGGTGGGCCGCAGGGCATGATGATCGCAGAGAGCTGGATGAGTGATGTGGCCTTGAGCTGCGGTCTGCCTGCCGAAGAGGTTCAAACCGAATAATTATTTCTCCCGCAGTCTAGACACATGCACACAAATGTTTCACAATCCTCTGCTGCTTCCAGGTGAGGAGGATGAACATGTATAATGAGGGAGATCTCACACACTTTAATCAACGTCTGGACCAGTTCACCATCGCTCGCTGCTGGGAGGAGTGCATGCAGCTCTCAGACTTCAACAAGCGCAAGGATGCTGTGGAGAAATACAACAGGTCAGAAAAAAAACATAATTTTAGATAAGTGTAGTAGAAATAATATTATATGAAGAATTATCATAACAATATAGTTAAGTATGTGTTATTTTACAGTTCTGTGCAAATATCTAAAGGCCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36465
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077553 Nonsense 1242 1351 34 36
Genomic Location (Zv9):
Chromosome 17 (position 33576541)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 33418272
GRCz11 17 33370783
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCTGTTCACGCTAGAGGAACTTCGCTACTCTCCTGACGGTTACCTATA[T/G]ACTCGTGGACCTGGCATGTATAAGATTCCTGCTTTTGGGGATATTCCCAG
Long Flanking Sequence:
GGTTCAAGCCAGTAGACCACTGGATGACAGGATAAATCTTGGGAATTTTTCACTATTTGATGGAGAGAGGACTTCATTTGTCTTTGCCATGATGACTGTACATAATATTTTACTAGACGTTATGCAAGATACAATAAGTCAAGATACTCAAGATAGGCTTAACTAGGCTAGTTATGCTAATTAGGCAGGTCATTGAACAACAGTGGTTTGTATAGCCAACAGAAACAAAATATTTCTAAAGAGGTCTTATTATTCTAATAATTTCTTATTATTCTTAATAACAGTGACCTTTTTCCTAAATGAGGGAATGTACACCTTTTGTAAAGCTGCTTTGGGAAAATAATCATTGTTGAATGAAATAGGGAGTTTGAATTGAATTTAATTGAATTGAATTGAATTGATTTACTTGTGCTACATTTGCAGGTAGAAGGTGGGTTCATGCAAGGCTTAGGTCTGTTCACGCTAGAGGAACTTCGCTACTCTCCTGACGGTTACCTATA[T/G]ACTCGTGGACCTGGCATGTATAAGATTCCTGCTTTTGGGGATATTCCCAGTGAATTAAAGGTTTCGCTGCTCAGAGATGCTCCAAATGACAAAGCCATCTTTTCTTCAAAGGTTAGATCCACACTAAGAGCATGGTTTGTATGTGTTGATCTCATGTACTGTACTATGGTTACACCACAGGTAGAGAGTTAACCAGTGTTTGTCAGATTTAATTCAATAGATGCCTGGTGTGTAAAAAACACACCAGGCATGGTGATAAGATAAAATTTTAACAAACAAGATTTAACAGTTAAATGGCTAATTCCCCTAATAATTCACCTAAAATTTAAAAATCTGTCATTGTTTACTCACACTTGTCACAAACAAGTTTGACTTATCTTCTTTTAGGTTCATTAAACTCATTAAGGTTTGGCTGTGTGTTTGTGTTCAGGCTGTGGGTGAACCTCCTCTCTTTCTGGCGGCCTCAGTGTTTTATGCCATTAAAGATGCCATCACAGCTG
Associated Phenotype:
Not determined