Busch Lab

ZMP

ABLIM2

Ensembl ID:
ENSDARG00000055223
Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Human Orthologue:
ABLIM2
Human Description:
actin binding LIM protein family, member 2 [Source:HGNC Symbol;Acc:19195]
Mouse Orthologue:
Ablim2
Mouse Description:
actin-binding LIM protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385758]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35293 Essential Splice Site Available for shipment Available now
sa17492 Nonsense Available for shipment Available now
sa17496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35293
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Essential Splice Site 277 615 8 19
Genomic Location (Zv9):
Chromosome 12 (position 24133349)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22662867
GRCz11 12 22784086
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCCTCCTTGCAGACAGGCAGCGCGTATGGAGGAGAAGAGCAAGG[T/C]AAAACTAACTGTAAAACTATCAGGTGATACAATACAAATGCCAAATTTTT
Long Flanking Sequence:
ATCCGGGTACTATGAATAATTTTGACTGCAATTGAATTAATTTCCATATTAACTTATATGCTTTATGATATGATTATCTCTCATGCTGCTGTTCTTGACTGTTTGGCGCCATCTTGTGACTCAATAAGTAGGTTAGTGTAGGCTGCATTCAGCCGTTTTTGTTTCTATCAGATTGATAAATATGTTAATAAGTGAATAAAGCTCAGACAAAAGAGTTGCATCCGATTATTTAGTTTTGTGACAATTCGCTATGTAACAGGGAGGGTAATGTACATCTAGTTAGTGGTTTTTGCAGAATAAAGCCCTGCAGACTTATACAACAAAGTCTGAGAAGCCTTTACTCTGCTAGAACAACCGCCTAGAGGTACATTATCCCTTACTTACACTTAAATTTGACCATTGAGGTGTCAACTTTATTTTTTGTCCTTCTTTTTTTACAGGTTCTACCATCTGGCATCCTCCTTGCAGACAGGCAGCGCGTATGGAGGAGAAGAGCAAGG[T/C]AAAACTAACTGTAAAACTATCAGGTGATACAATACAAATGCCAAATTTTTGTATTTTAGTGAGCCTAGATGATATTGGTGAGATGATAGTATAATTACAGTCAAGGTGCGATTTAAAAAGGGGGGTTTGACACTCCTAATTAACGATTGATGCTCGTGAAGGATGTCAAGCAATATGTGTGGGTGATCTGCCCTTTAGATGGTAGATGAATGTTTGCACTGAACTATATTGTTTAGAAATAATAAAAACATACATTTGATCGTGCCTCCATGATGGTTCATATCAGCTCATGATCAACTCCAGTTGTCTGAATCTGGCAGATCGAGCACATATTTGTGTAATACTTAACCATGCCTTATTGAATAAAAAATATATATAATTAATTTTTTAATATATATTTAATTTACTTTATAAATATTTTTTTCTTTAAAAACAATGTATAAAATGTATAGTTTTACTAGTTACATTAAAATATAAAATATTTTATCCTTCACAATCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27951
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 375 615 12 19
Genomic Location (Zv9):
Chromosome 12 (position 24138124)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22667642
GRCz11 12 22788861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTGCTTGTAGGGAGATGGGGAAAAGTCTCCCCGTCAGAGGAGGCCCT[C/A]GAGCCCCAGCTCCAACAGCTCTTTAGGAGGCTATGGTCGCTATACGCCTT
Long Flanking Sequence:
GTGGTTTTTATAGGAGGGAAGTCCCTTTCTGAAATTGTAGGTGTACTGCAAATTTCAATCTTTGGACCAATGTATTGCTTTATTGTTTTTAAGTTTGTTTTTAATCACAATAAACAAACTTGTTACATGATGGACCAGATCAACTAGTTAAAAACACAAGCAAGATTAATGAACGAGGCCTTGTTTTCCTCATAATTTGTGAATAGTTGTGGTTTAGTGAACTGCGCGGTATTGTGTGTTGTTTTTCTCCATGTTTCTCCATGTTTGAAACTCTGTGGTGTCAGACTCTCAATGATCAGCCTATTACAAGTTAGGACTGATTATTGTAAACTGGTTGCATCTGTGTTTCTTTTCCAGCTTTGTAGTCGCCTCCTATGTGTAGTCTCCACTGCCATAGTGATCACCCTTTTACTAGACTAAATGAAGATTTTGATTTTATTGAATATTGTCTGTTTGCTTGTAGGGAGATGGGGAAAAGTCTCCCCGTCAGAGGAGGCCCT[C/A]GAGCCCCAGCTCCAACAGCTCTTTAGGAGGCTATGGTCGCTATACGCCTTCCCGCTCACCACAGACCTACAGCAGACCAGGTATCCCTCCACATATGCAGTTATCTATAAGTATTTTAAATGATTTGAATGTAATGGAGCTGTAAACATTATCATTTTCCTCATACACTATTATTTAAAATGTTGCACTGTGTATATTTATCAGTTATATACTGTGTGTTTTTATATATTTACACTACCATTCAAAAGTTCAGAAAGGTTTTACTGGTCAGTAAAAAAAATAAAAAAATAAAAAAATAAATAATAATAATAATAATAGTAATTTAATTATGTAGGGTCACCGATCGAAATGTAACATCTTTTAAATGCAGTGTTTAGATTTGTGAAGATTCTTTGCTCAGAGATTTTGGAACAAGATTTACAGACTATGCAAAGCATATTTTGACAATTCTTGTGATCTCTGGGAGCAGCTTCTATAGCACTATAGCACTATAAGCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 474 615 13 19
Genomic Location (Zv9):
Chromosome 12 (position 24141727)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22671245
GRCz11 12 22792464
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCCCACTACTCTGGCTTTACTCCAGCAGCACAACTACATCCCTTACTTC[A/T]GAGGTACCACAGCTTTGCCWGCAGGYCTTTGCCAGTACCAATTTATCACA
Long Flanking Sequence:
CTTTCTTTTTAAAAGTAAAATCTCAGCCCCCCTAAACATTTGAATGGTAGTGTATGTTTATTAAAGCAGAACACAAACTCATATTGTGCTGCATACTAATAAGAATCGTTATGAAACATTCCAAATCATTTATTCAGTCTGAAAAGCAACAGAGTTAAAGCATTAAAACTGATTTGATGCAGAAATTTAGAAACAAAGACATTCACAAATCATTTAGTTCTTAGTATAGTTGCTGATGTTATATTACTTCTATTCTTCCCTGGACCAACTGGGCCTCTTGCTTAGACCAGTATCTGAGCATCAAATACACCACCCAGCCAGAAAATTCCCACTTGCTCTCTGTACCAACCTCGGGGAGGAGTAGTGCCCATGGTAGTGCCAGAGGCTCCTCCCCGCTGCCTCTGTACAACAGCAGTGGTAGAAACACACCCCAGGCAGCCCTGCTTCTCAACCCCACTACTCTGGCTTTACTCCAGCAGCACAACTACATCCCTTACTTC[A/T]GAGGTACCACAGCTTTGCCTGCAGGCCTTTGCCAGTACCAATTTATCACAAACTGCACTTAACTGTGTGCTTGGATTTGATTGGTACAAGATTTACCCCTGCCGGGCAATATTAATAATGAACGAGTGCAAAAGTGAAAAAGCTGTATAAGAATTTGAGTTACACTAATGTGCATGAAGTTCCTGCCGTTGGTATTAAATTGCAACACAAATGAAGCATGGATCAAGCCTAATAATTCAGAGTTTAATAACTGTTTGCATTCAGTCTGAAGGACTAGTGAATTGCAGACATGAAATTACTACCCTATCCTTCATCCACCTTTCCTGAACAGGAATTGAGACAGGATTCAGACAGGAAGCAAAGTCTGAAAGTAGGCCTAGGACAGCCCTGCACCTCAATTTGCCTTCTCACGGTAAACCCTAAAAACCAGATTCTCTTTCACTGTGTATCACCGGTCTATTACAGTGATGTGAGGTTGTAGGTGTGCCACAAGGTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17496
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077548 Nonsense 611 615 19 19
Genomic Location (Zv9):
Chromosome 12 (position 24158879)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22688397
GRCz11 12 22809616
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTAGGCAGCTGATCTTGGTGAGGATGAGRCAGACCATGATTCATCCT[G/A]GAGTGGAATGAGAGGTGANNNNNNGTTTGACTTATAGACCATAAATAAGA
Long Flanking Sequence:
AGAAATGGCATTTTTATCTATTTATGCCATGTCTTCATAAAACATGATATTTACTCAATATTTACTATAATTTGGCTATAATTCTAACCATTTTGACCCATACAATGTATTTTTGTCAAATGGCAAAATTATACTTGTGCAACAAAAGACTAGTTTTGTGGTCCAGAGTCACATTTGCACTCAATAATTTGGTGAATGCTTTTATCCAAAGTGACTTACAAATGAGATCAAGTAATTAAAAGTAACAAAAGACAACCTGTAAAGACATTTCTCAGTTAGTGTAATGCACTACACAAATGTTATAAATATAGTGCTCAAAAAAATAAGGTAACAGTTGGAGTTACATTGAGTTAAGTGTTCCCTTTATTTTTCGAACAGTATATATTATCACACATTCAGCTATGAATAACATGTTCTGACTAGAGTTAAATAAAGGCCTGGTTTTGCTTTTCTCTAGGCAGCTGATCTTGGTGAGGATGAGGCAGACCATGATTCATCCT[G/A]GAGTGGAATGAGAGGTGAGTTTGTGTTTGACTTATAGACCATAAATAAGAAGCATTTGTTCCACAAAAGATTATTGGTTGTAATTTGTGTTACTCTTTCTCTTTTTTTTCAATCTCTTCCTGTTTTCCATGCCTTTTCAGAGTACAAGGTAAGATATTGTGTTTTTAAGGGAATGCTGTAGCTTTTCAAGTCAGTGACTAAAATAGGTTGTTAGTAGACTGTTCTTATTGGAGGGTAAATTTTATATGAAAGTAACAAAGCATAACCAACCAGTATTAAATACAAATTTACTTGCATGGTAACTGGATTTGGTTTTAAGATGATATCAATAGTATTATTTGAAATGAATAGAAAAATTGTTCATTGTTTCCATTCTGCTTATGCTATTTTAGAGGTTTAAGCAGTGTTAGTTCTCATGACAGTTTTAGAAAATAACGCAAAATTTCGCACAGCATTTCGTGAAAATATGCATTTGTTTAAAATATGTCATACTGAGCCTA
Associated Phenotype:
Not determined