Busch Lab

ZMP

si:dkeyp-68f9.12

Ensembl ID:
ENSDARG00000055159
ZFIN ID:
ZDB-GENE-030131-1060
Description:
Si:dkeyp-68f9.12 protein [Source:UniProtKB/TrEMBL;Acc:Q502F8]
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21547 Nonsense Available for shipment Available now
sa34706 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21547
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077479 Nonsense 118 522 2 9
Genomic Location (Zv9):
Chromosome 9 (position 39500981)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38638877
GRCz11 9 38448672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACCAGTGTGGAGCTACTGGAAGAACTTCTTCGAAAAGATGAGAAATA[T/A]CCATGCAGAGGATACATGACTCTGTGGACAGAGCATCGGGACTTAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34706
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077479 Splice Site, Nonsense 413 522 7 9
Genomic Location (Zv9):
Chromosome 9 (position 39508971)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38646867
GRCz11 9 38456662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTATTGCAGAAAGTGAAGTCATCATTGGTGAATACCTTTTTCCTAAA[A/T]AGGTGAATTGGCCTCGTGTTAGGATAGGAAGTAACAAAATGTTGTCCATT
Associated Phenotype:
Not determined