Busch Lab

ZMP

slc8a4a

Ensembl ID:
ENSDARG00000055154
ZFIN ID:
ZDB-GENE-060110-2
Description:
solute carrier family 8 (sodium/calcium exchanger), member 4a [Source:RefSeq peptide;Acc:NP_0010828
Human Orthologue:
SLC8A1
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:11068]
Mouse Orthologue:
Slc8a1
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:107956]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37330 Nonsense Mutation detected in F1 DNA Not yet available
sa39332 Nonsense Mutation detected in F1 DNA Not yet available
sa37329 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37330
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077478 Nonsense 161 939 1 7
ENSDART00000135052 Nonsense 161 939 2 8
Genomic Location (Zv9):
Chromosome 21 (position 26517028)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27085939
GRCz11 21 27122634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTCCCGAAATCCTATTATCCGTGATTGAAGTCTGCGGACACAAGTTC[G/T]AAGCTGGTCACTTGGGCCCGAGTACAATCGTAGGAAGTGCTGCCTTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39332
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077478 Nonsense 629 939 3 7
ENSDART00000135052 Nonsense 629 939 4 8
Genomic Location (Zv9):
Chromosome 21 (position 26455538)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27024449
GRCz11 21 27061144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGATCCTGGAGGTGAAGATCATTGACGATGAGGAGTACGAGAAGAAC[A/T]AAACCTTCACCATCCACCTGGGGGAGCCGGTGTTGCTGGAGATCGGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077478 Nonsense 858 939 7 7
ENSDART00000135052 Nonsense 858 939 8 8
Genomic Location (Zv9):
Chromosome 21 (position 26443093)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27012004
GRCz11 21 27048699
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTCTTCCTGGGTATCGGAGTGGCGTGGACCATCGCTGCAGTGTACTG[G/A]CACAGTCAAGGCAAAAAATTCCAAGTCCCACCAGGGTCATTGGCGTTCTC
Associated Phenotype:
Not determined