Busch Lab

ZMP

smyd2a

Ensembl ID:
ENSDARG00000055151
ZFIN ID:
ZDB-GENE-050320-126
Description:
SET and MYND domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001013568]
Human Orthologue:
SMYD2
Human Description:
SET and MYND domain containing 2 [Source:HGNC Symbol;Acc:20982]
Mouse Orthologue:
Smyd2
Mouse Description:
SET and MYND domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915889]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1004 Essential Splice Site Available for shipment Available now
sa10184 Nonsense Available for shipment Available now
sa11935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1004
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077459 Essential Splice Site 136 435 4 12

The following transcripts of ENSDARG00000055151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 32958873)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32800604
GRCz11 17 32753115
KASP Assay ID:
554-0908.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAAGGACGCCTTCAGAGAGAGTGCTGACGCTTCGAGAATTAGAAGCAC[G/A]TAAGTGTCTAGATGATTTCTGAGTGAGGCAAACACTGTCTTTATAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10184
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077459 Nonsense 281 435 9 12

The following transcripts of ENSDARG00000055151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 32955094)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32796825
GRCz11 17 32749336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCCTTTTTTTNCCTTTTTTGTAGGATGAAGCCAAAATGGAGATCCGT[C/T]AGAAGCTCAGCACACCTCCAGAGGAAGAGGAAATCAAACAGATGGTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11935
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077459 Nonsense 318 435 10 12

The following transcripts of ENSDARG00000055151 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 32952918)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32794649
GRCz11 17 32747160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGGTTTTGACGTAAAGTTCCTTGACCTCCAAGCACCCCCCAGTGAAT[T/A]GTTGGAAATCTGTGAATTAAGCATGGAGAAAATGGGTGCAATCTTCGCCG
Associated Phenotype:
Not determined