Busch Lab

ZMP

si:ch211-152h14.2

Ensembl ID:
ENSDARG00000055133
ZFIN ID:
ZDB-GENE-080917-16
Human Orthologue:
CENPF
Human Description:
centromere protein F, 350/400kDa (mitosin) [Source:HGNC Symbol;Acc:1857]
Mouse Orthologue:
Cenpf
Mouse Description:
centromere protein F Gene [Source:MGI Symbol;Acc:MGI:1313302]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa12296 Nonsense Available for shipment Available now
sa23122 Essential Splice Site Available for shipment Available now
sa11610 Nonsense Available for shipment Available now
sa36462 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39168 Nonsense Mutation detected in F1 DNA Not yet available
sa10281 Nonsense Available for shipment Available now
sa23121 Essential Splice Site, Missense Available for shipment Available now
sa28888 Nonsense Mutation detected in F1 DNA Not yet available
sa28887 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa36461 Nonsense Mutation detected in F1 DNA Not yet available
sa12055 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4717
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 207 1737 5 18
ENSDART00000087589 Nonsense 207 2861 5 26
ENSDART00000128418 Nonsense 201 953 5 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32946216)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32787947
GRCz11 17 32740458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTAAAGCTTCTAAACCAGTCTTCGGTGAGCCATAAGGACATTGCAAGA[C/T]AGCAGACAGGGTCCTCAATATTTCCTTGGCAGCAAGATCAAAAAAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12296
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 256 1737 5 18
ENSDART00000087589 Nonsense 256 2861 5 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32946069)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32787800
GRCz11 17 32740311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCTCTGGGATGCCGTGGTCTTATGATGACACACCAATAAAACCCCAY[C/T]AGCAGTTCACATCAGGCGCACCGAGTGACACAGTTGGATCACAGCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23122
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Essential Splice Site 433 1737 8 18
ENSDART00000087589 Essential Splice Site 433 2861 8 26
ENSDART00000128418 Essential Splice Site 415 953 9 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32944490)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32786221
GRCz11 17 32738732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGCAAGCCAAAAAAGACCACAATGTTTTGCAATCAGAAATGGATAAGG[T/C]AATTTAATGTGGCATTTCTTTCTTTCTTTCTAGTTTCAAACATTATACAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28889
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 523 1737 11 18
ENSDART00000087589 Nonsense 523 2861 11 26
ENSDART00000128418 Nonsense 505 953 12 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32943885)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32785616
GRCz11 17 32738127
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATTTATGATTTATCCCAATATTTAAACTTGTTCATTTTAGTTAAGACA[C/T]AAACCCAGAATGAGGAACTAACTGAGCTACGCAAAAAAATGGACCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 899 1737 12 18
ENSDART00000087589 Nonsense 994 2861 11 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32942472)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32784203
GRCz11 17 32736714
KASP Assay ID:
2261-1277.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAAAAACTGCATGATGCTGWTTGCCAAGAGAATGCAAATCATCTTAAA[G/T]AGATTTCCATARTGACAGAAGCACTTGCTGAAAAAGATGCCATGGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36462
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 None None 1737 None 18
ENSDART00000087589 Essential Splice Site 1051 2861 12 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32942287)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32784018
GRCz11 17 32736529
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTTGACTCTTCTGTAGAGCTAATTTCGAGTCTGGAAAAAAAATTGCA[T/G]GACATGTCTGATGAAAAATCTTTATTAGAGATCAGTATCAAGGAGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39168
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 None None 1737 None 18
ENSDART00000087589 Nonsense 1187 2861 12 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941878)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783609
GRCz11 17 32736120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCTCTGTCTGATTTGAAAAACCAAGAAGCAGCAAAGTCCTGTGAGATT[G/T]AAACTTTGAAAGAAAAACTTCAGAAGGCTCAGTCTGAGCATGCTAAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 1038 1737 14 18
ENSDART00000087589 Nonsense 1256 2861 12 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941670)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783401
GRCz11 17 32735912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCACAAGTAGAGGAGCTGCAAGGCAACGTTAGCATTCTTGAAGCAAAAT[T/A]AAGTGAGAGTGAGGCCCAGAGGTCCAACCTAGAATCAAAGCTTGAATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23121
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Essential Splice Site 1039 1737 15 18
ENSDART00000087589 Missense 1305 2861 12 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32941524)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32783255
GRCz11 17 32735766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTTGTTTGGAGGAATCCCAGAAGGAACAACAGTCTCGTTCTGTATTA[G/A]TTGCTGAGTTGGAGTCTCTCCGTGTAATCCATGAACAACTAAAAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 Nonsense 1270 1737 15 18
ENSDART00000087589 Nonsense 1536 2861 12 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 None None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32940831)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32782562
GRCz11 17 32735073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGCCAAACTAAAAGAAGAAAAGCAGCACACAGAGATCTTGTCCTCG[C/T]AGCTGGAGGCAACCATGCAACAACTGCAAGAATTAGACATTGCATCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 None None 1737 None 18
ENSDART00000087589 Nonsense 2314 2861 16 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 Splice Site None 562 None 8
Genomic Location (Zv9):
Chromosome 17 (position 32937140)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778871
GRCz11 17 32731382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACTTGATGCTATGAAGCTGATGAACGTTGAACTTACGGGAAAGGTAT[T/A]ATTTTTTTCCCCATCACCTTTAATGGTTTTTAATTTCTCCCCTCACATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36461
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 None None 1737 None 18
ENSDART00000087589 Nonsense 2340 2861 17 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 Nonsense 91 562 2 8
Genomic Location (Zv9):
Chromosome 17 (position 32937040)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778771
GRCz11 17 32731282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGTCACATATATTGATTGATATTTGTTAATTTTCAGTTAAATTCGCTA[C/T]AAGAGAGCAGTTTGCATCTTGAGACACAACATAAGCAAGAGCTATGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12055
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077444 None None 1737 None 18
ENSDART00000087589 Nonsense 2381 2861 17 26
ENSDART00000128418 None None 953 None 13
ENSDART00000135517 Nonsense 132 562 2 8
Genomic Location (Zv9):
Chromosome 17 (position 32936917)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 32778648
GRCz11 17 32731159
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGATTAATCAGAATCTTTTGACTTGTCAGCTGCAGGAGTCTCAAAAA[C/T]AAATTGAAGARTATAAGGTAAGAATATTCTTCACCATATTTTACTCTGGC
Associated Phenotype:
Not determined