Busch Lab

ZMP

ARMC4

Ensembl ID:
ENSDARG00000055128
Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Human Orthologue:
ARMC4
Human Description:
armadillo repeat containing 4 [Source:HGNC Symbol;Acc:25583]
Mouse Orthologue:
Armc4
Mouse Description:
armadillo repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:1922184]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9510 Nonsense Available for shipment Available now
sa42032 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8644 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2659
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 459 1047 9 19
Genomic Location (Zv9):
Chromosome 12 (position 24441772)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22971290
GRCz11 12 23092509
KASP Assay ID:
554-3417.1 (used for ordering genotyping assays)
KASP Sequence:
AGCATGAGAGACGTGCTGAAACTGCTACCGACCTTCCTTCTGAATACTGG[C/T]AGATCCAGAAACTWGTCAAATACTTAAAGGTAAAAAAACTTATTTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9510
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 604 1047 12 19
Genomic Location (Zv9):
Chromosome 12 (position 24418002)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22947520
GRCz11 12 23068739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTGGAGTTGTTGGACTGTGTGCCTGCRGGAGAGTCTCTGARTCTGGAG[C/T]AGCAGAGGGATGTGGAGGTGGCTCGCTGTGGGGCTCTGGCTCTCTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42032
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Essential Splice Site 835 1047 15 19
Genomic Location (Zv9):
Chromosome 12 (position 24399920)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22929438
GRCz11 12 23050657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTCACGAAGGCCGTTGGCGCCTGCGCCACTGACCCCGAGAACATGATG[T/A]GAGTGTCTAAGATGGATTGAGTCTTGAATATGTCAAATAATATCACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8644
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077453 Nonsense 988 1047 18 19
Genomic Location (Zv9):
Chromosome 12 (position 24386780)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22916298
GRCz11 12 23037517
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTACGATATCTTTACTCAAAAGATCCTTCAGTGCATCAAGCAAYAGCA[C/T]GAGCCCTGTTTGAGCTGTCTAAAGACCCCAAYAACTGCATCACCATGCAT
Associated Phenotype:
Not determined