Busch Lab

ZMP

si:dkey-44g23.7

Ensembl ID:
ENSDARG00000055101
ZFIN ID:
ZDB-GENE-040914-13
Description:
heme oxygenase 2 [Source:RefSeq peptide;Acc:NP_001096609]
Human Orthologue:
HMOX2
Human Description:
heme oxygenase (decycling) 2 [Source:HGNC Symbol;Acc:5014]
Mouse Orthologue:
Hmox2
Mouse Description:
heme oxygenase (decycling) 2 Gene [Source:MGI Symbol;Acc:MGI:109373]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8475 Nonsense Mutation detected in F1 DNA Not yet available
sa13370 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29810
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077783 Essential Splice Site None 310 None 6
ENSDART00000138311 Essential Splice Site None 242 None 5
Genomic Location (Zv9):
Chromosome 22 (position 27487218)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 27002663
GRCz11 22 26865115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATGTGAACTGCAACGGGTTGCTTTACCTTAAACACTGCGAAATCAGG[T/A]AATATAAACGATTCTGCTTTCCATCGGTAAAAAAACAACCTGACAGGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8475
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077783 Nonsense 116 310 4 6
ENSDART00000138311 Nonsense 116 242 4 5
Genomic Location (Zv9):
Chromosome 22 (position 27483019)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26998464
GRCz11 22 26860916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGGCRAGAGGCCTTGGCCAAAGACCTGGCGTAWTTCTATGGTGAAGACT[G/A]GGAGAGCCAGATYTCCTGCTCTGCTGCCACACAGCCCTATGTAGACCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13370
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077783 Essential Splice Site 227 310 4 6
ENSDART00000138311 Essential Splice Site 227 242 4 5
Genomic Location (Zv9):
Chromosome 22 (position 27482683)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26998128
GRCz11 22 26860580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCAAGCTGCTAGATGAAGCCAACCTGGCTTTTAAATTGAACTTGGACG[T/C]AAGAGGATATAATTTCCATTYACTGGTTGWGATAATCAGATGATTATTGT
Associated Phenotype:
Not determined