Busch Lab

ZMP

fam184b

Ensembl ID:
ENSDARG00000055099
ZFIN ID:
ZDB-GENE-090313-380
Human Orthologue:
FAM184B
Human Description:
family with sequence similarity 184, member B [Source:HGNC Symbol;Acc:29235]
Mouse Orthologue:
Fam184b
Mouse Description:
family with sequence similarity 184, member B Gene [Source:MGI Symbol;Acc:MGI:2442958]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32672 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24844 Nonsense Mutation detected in F1 DNA Not yet available
sa16579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32672
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Essential Splice Site 114 1165 3 19
ENSDART00000145942 Essential Splice Site 54 1105 2 18
Genomic Location (Zv9):
Chromosome 1 (position 22310332)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22845499
GRCz11 1 23536238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAAGATGAATAGATTCACTTTCTTTAACCTGGCAAATGTATCCATCTT[A/C]GGTGGAGGAGCGTGGACAGAGGGCTGAAATAGAGTATGCAGAGCGCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 548 1165 7 19
ENSDART00000145942 Nonsense 488 1105 6 18
Genomic Location (Zv9):
Chromosome 1 (position 22300740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22835907
GRCz11 1 23526646
KASP Assay ID:
554-7814.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCACTGAAGAAGACAGAAAGCTTTTAGAGACAGAGAGGGAAGAGCTGTG[C/A]AACCAGCTACAACTGTCCAAAACAGAGGTAAGTTATCACAATGTATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16579
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 793 1165 12 19
ENSDART00000145942 Nonsense 733 1105 11 18
Genomic Location (Zv9):
Chromosome 1 (position 22295819)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22830986
GRCz11 1 23521725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAGCGGGGGTGGCGTGAGCGAGAGGAGGAGCTGTTGCGTGTGGAGAGGT[T/A]AAATCACCAGCGAGCTCTTCAGRTCCTGRAAACACAAGCCAATGAAGAAC
Associated Phenotype:
Not determined