Busch Lab

ZMP

C9orf4

Ensembl ID:
ENSDARG00000055069
Description:
chromosome 9 open reading frame 4 [Source:HGNC Symbol;Acc:1362]
Human Orthologue:
C9orf4
Human Description:
chromosome 9 open reading frame 4 [Source:HGNC Symbol;Acc:1362]
Mouse Orthologue:
6430704M03Rik
Mouse Description:
RIKEN cDNA 6430704M03 gene Gene [Source:MGI Symbol;Acc:MGI:2442704]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32093 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32093
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077376 Nonsense 90 282 2 5
Genomic Location (Zv9):
Chromosome 16 (position 29428447)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26080980
GRCz11 16 27170151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGCACCCCCTGTGGACCCATTTGCCCGCATCAAAGTCAGCGACTGT[G/T]GAGTAACCAAAGGATGCATCAGGTCTGTGCATGCAATGAAGGTTTATGTA
Long Flanking Sequence:
ATTTATTTAACTAAAATTATTGAAGCTGGCACAGTGGCCACTGGGGACTTGGATGTCAAGATCTCAGGACGTGATCTGTTTTTTTCTAACAGTTTAAACATATGCATTATAGGTCAGTTGGATGAACTAAATTGGCTGTTGTGTGAATGAGAGAGTGTGTGGGTATTCCAGCACTGCGAGTTCACAAGTTTTTAGGGTCACGAGTTAGGTTAGTGGCTAAAAGAGCATCCACCACATAAAACATATGCCAGAGAACTGGTGGTTCATTCCTCTCTGGACACCCCTGATAAATCAGAGAGTAAGCCGAAGGAAAATGAGTGAGTAAAATGAATTGATGAATAAACAACATCATCCATGATTGTTATCTGCAGTTGTGTTGGTAGCAATCAAAGACATCTGTCTGAAAGCAGCTCAGTAGTGTTATTTGTTGCCTCACAGGTTACCCTTTCCCAACTGCACCCCCTGTGGACCCATTTGCCCGCATCAAAGTCAGCGACTGT[G/T]GAGTAACCAAAGGATGCATCAGGTCTGTGCATGCAATGAAGGTTTATGTATAATATCAGAGGTCAAATCATTTAACAGGAGTGTTGTATTGCAGTATTAAGCTGCTGTCTGCCATGCTGCCACACACCCTTGTGTTAATGTTGTCAATCAGACCAGACCAGTCGGACTAGTTACTGATCTCGCTAAAAAACAAATTGCCTCAATTTATTCTTTCTCTTTCTATTCATTAGATATGGCAAACCAGGCTGTGACGCAGAGTCCTGTGACTATTTCCTGAGTTTCAGACGCATTGGCACAGATGTGGAATTCGAGATGAGTGCAGACACTGATGGATGGGTTGCCGTTGGTTTCTCTTCAGATAAAAAGATGGTAAAAAGAGTTAGTATAATCTGTGGATGCTTTCAGACATGCTATGATATACACAATAATATTGTTGTTGTAGGGAGGTGATGATGTCATGGGCTGTGTTCATGATGATAACGGACGTGTACGGATCCATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7791
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077376 Nonsense 165 282 4 5
Genomic Location (Zv9):
Chromosome 16 (position 29428955)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26080472
GRCz11 16 27169643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGGCTGTGTTCMTGATGATAACGGACGWGTACGGATCCATCATTTCTA[T/A]AATGTGGGCCAGTGGGCCAAAGAAATCAAGMGCAACCCAGCACGGGATGA
Long Flanking Sequence:
CAAAGGATGCATCAGGTCTGTGCATGCAATGAAGGTTTATGTATAATATCAGAGGTCAAATCATTTAACAGGAGTGTTGTATTGCAGTATTAAGCTGCTGTCTGCCATGCTGCCACACACCCTTGTGTTAATGTTGTCAATCAGACCAGACCAGTCGGACTAGTTACTGATCTCGCTAAAAAACAAATTGCCTCAATTTATTCTTTCTCTTTCTATTCATTAGATATGGCAAACCAGGCTGTGACGCAGAGTCCTGTGACTATTTCCTGAGTTTCAGACGCATTGGCACAGATGTGGAATTCGAGATGAGTGCAGACACTGATGGATGGGTTGCCGTTGGTTTCTCTTCAGATAAAAAGATGGTAAAAAGAGTTAGTATAATCTGTGGATGCTTTCAGACATGCTATGATATACACAATAATATTGTTGTTGTAGGGAGGTGATGATGTCATGGGCTGTGTTCATGATGATAACGGACGTGTACGGATCCATCATTTCTA[T/A]AATGTGGGCCAGTGGGCCAAAGAAATCAAGCGCAACCCAGCACGGGATGAAGAGGGCATCTTTGAAAACAACCGCGTCACCTGCCGCTTCAAACGGCCTCTTCATGTGGCACGCGAGGAAACACTGGTGGACCTGCACCTGAGCTGGTACTATCTGTTCGCTTGGGGACCTGCTATACAAGGTAAGTCATTTGGTCTGATTTTAGAGCTTAGTTCATACTGCACCGTTTAGTGGTGCAAGAAAATATCGGTTGCACTTTATTTTACAGGGCATATACTGTACATACTGTGTACTTTGCTTAGCATGTACTTTGTGATGTAAGATATATTAGGTTACAGGGTTTGTTTAGGGACAGTAAATTTAAAGTCCTTTTGAAATCAAAAATTACAATGTTGATTTTTTTTCATAGCACGTTGTTATTCTTTAGGTGAAAAAATGCAAGTTAATCCACAAAACAAATGTTTTTATCTTCAATCAAAGTCCAATTGCTTCCACATTTG
Associated Phenotype:
Not determined