Busch Lab

ZMP

bcl9l

Ensembl ID:
ENSDARG00000055054
ZFIN ID:
ZDB-GENE-040927-29
Description:
B-cell CLL/lymphoma 9-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q67FY3]
Human Orthologue:
BCL9L
Human Description:
B-cell CLL/lymphoma 9-like [Source:HGNC Symbol;Acc:23688]
Mouse Orthologue:
Bcl9l
Mouse Description:
B-cell CLL/lymphoma 9-like Gene [Source:MGI Symbol;Acc:MGI:1933114]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36718 Nonsense Mutation detected in F1 DNA Not yet available
sa44897 Nonsense Mutation detected in F1 DNA Not yet available
sa39214 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29084
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Essential Splice Site 205 1531 5 9
Genomic Location (Zv9):
Chromosome 18 (position 42302418)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43907790
GRCz11 18 43901244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCCCCTCAGCAAGTAGTGTATGTCTTCACCACCAGCCTAGCTAATAGG[T/G]CAGTATGGTTTCTCTATTCTGTTCAAATAGGATTTGCAGCTTAATATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36718
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 539 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42300776)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43906148
GRCz11 18 43899602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAGCATGGAGGAAGCTACAAGAAGAATACTACCAGGAGAAAAGGCGA[C/T]AACATGATATGAACCCCCACCAGCATCCCCAGCATTTCCGCATAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44897
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 582 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42300647)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43906019
GRCz11 18 43899473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGATGAGGGGTCCTCCACCACCATATCATAGTAAACCTGGTGATCAG[C/T]AGTGGGGGCCTGGTCCAATGGTAGGGGGAGGAATGGGAGGGAATGCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39214
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 880 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42299752)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43905124
GRCz11 18 43898578
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATATGTATGGACCAGACCAGCCAGGTCCTCCCCATCTGAGCAGCACTT[C/A]GAGACTTAGTCACATTCCCATGAACACTGGATCAAGGGTTACAGACCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29083
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 1144 1531 9 9
Genomic Location (Zv9):
Chromosome 18 (position 42298686)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43904058
GRCz11 18 43897512
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAACCACCAGTCTGCGCAGATGCTCCTTTCCTCACAGGGTGCAATG[G/T]GACCTCACAGTGGTCCACAAAGTCCGATGGGAATGGTACTTCAAGGAGGC
Associated Phenotype:
Not determined