Busch Lab

ZMP

LOC564761

Ensembl ID:
ENSDARG00000055053
Human Orthologues:
ITIH1, ITIH3
Human Descriptions:
inter-alpha (globulin) inhibitor H1 [Source:HGNC Symbol;Acc:6166]
inter-alpha (globulin) inhibitor H3 [Source:HGNC Symbol;Acc:6168]
Mouse Orthologues:
Itih1, Itih3
Mouse Descriptions:
inter-alpha trypsin inhibitor, heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:96618]
inter-alpha trypsin inhibitor, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:96620]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa12713 Essential Splice Site Available for shipment Available now
sa41764 Nonsense Mutation detected in F1 DNA Not yet available
sa31810 Nonsense Available for shipment Available now
sa21835 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3795
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 36 905 1 21
Genomic Location (Zv9):
Chromosome 11 (position 3708688)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3627192
GRCz11 11 3646579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAGCTCAAGTCACAATCAAAGWTGACAGCAACAACTCTGCAAAACAG[G/A]TATGGTTTATCAATTCTGTGCTTCAGTGCATTTATGCGTTTTATTTTCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2618
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 46 905 2 21
Genomic Location (Zv9):
Chromosome 11 (position 3706673)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3625177
GRCz11 11 3644564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCRWACTATGTTTCTCTCAGATTGAACTGCAAAGCATGCGAGTGGACTG[C/A]AAGGTTGCGTCTCGTTTTGCTCACACYGTCATGACCACCAGAGCACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12713
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 123 905 3 21
Genomic Location (Zv9):
Chromosome 11 (position 3706364)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3624868
GRCz11 11 3644255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAAGTATGAGAGCGCTGTRATATCCGGTCAAACTGCTGGCCTGGTTAA[G/A]TAAGTACAGATCAACGCTGAATTTCTGGCATGCTAACTAAGTACACGTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3786
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 659 905 16 21
Genomic Location (Zv9):
Chromosome 11 (position 3696220)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3614724
GRCz11 11 3634111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATGAAGGTGGCACTGCTTCCCAAAGAAGGTTRACWCCTTCATCTTTAG[G/A]TAAGAAGAGCATAGTTTGGAAAAATCTAAAGAGTAGAGAAAAANCTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41764
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 720 905 18 21
Genomic Location (Zv9):
Chromosome 11 (position 3694743)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3613247
GRCz11 11 3632634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCATCGGAGATAAGAAGATCATCCCAGGGAGCAAGTTGCACACTTA[T/A]TTTGGCCGCTTTGGGATTGTTGATGAGAAATTGGGTATCAGACTGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31810
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 734 905 18 21
Genomic Location (Zv9):
Chromosome 11 (position 3694703)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3613207
GRCz11 11 3632594
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCACACTTATTTTGGCCGCTTTGGGATTGTTGATGAGAAATTGGGTATC[A/T]GACTGATGGTGAGCACACAGGAGATCTGGGTGTCCGAAGGAGGAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21835
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 823 905 20 21
Genomic Location (Zv9):
Chromosome 11 (position 3693269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3611773
GRCz11 11 3631160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTAATCCTGAAGTTACCAACAGTTTCATTTGGTGTCAAATTTTAATGC[A/T]GGTCAATTCTACCACGGCATAAACTTTGAGGTCAGTGACTTATTTCCAGG
Associated Phenotype:
Not determined