Busch Lab

ZMP

col4a1

Ensembl ID:
ENSDARG00000055009
ZFIN ID:
ZDB-GENE-081105-114
Description:
Novel type IV collagen alpha chain protein [Source:UniProtKB/TrEMBL;Acc:B8JK27]
Human Orthologue:
COL4A1
Human Description:
collagen, type IV, alpha 1 [Source:HGNC Symbol;Acc:2202]
Mouse Orthologue:
Col4a1
Mouse Description:
collagen, type IV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88454]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa21437 Essential Splice Site Available for shipment Available now
sa27345 Nonsense Mutation detected in F1 DNA Not yet available
sa41357 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16923 Nonsense Available for shipment Available now
sa34560 Nonsense Available for shipment Available now
sa45346 Nonsense Mutation detected in F1 DNA Not yet available
sa34559 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21437
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 None None 1601 None 50
ENSDART00000130442 Essential Splice Site 26 1644 2 52
Genomic Location (Zv9):
Chromosome 9 (position 8714870)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8694713
GRCz11 9 8673043
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCCTCCTAGTGTTTCAAAGCTGACATAATTTTTCATCTTTTTCTTTC[A/T]GGGTGGATGCTCGGGGTCTTCATGTGGTGGTTGTGACTGCAGCGGTGTTA
Long Flanking Sequence:
ATTGTGAGCATTCAGTAGCATTTTGTGTTATTATTAACACATTGTTCATCTCAAATAAATATAAAGTGCAGTTTTACTTGAGCCAACACAAAAAGTAACTTTTATATTGTAGTGAAATATTAAATCTCTGTCTTTAAAGCCTTTAGCTTATGTGTCTGTTTCAGACCCTGCACATATTAAATACATTTCTCGTAGCTGTCCTGGAGTAAAATATTGTTAAAAAAATGACTAATGTGGATCAATACTGTTCAACATGAAATCATGCCACTTTCTTCTATTAGCATTTTCTAAAAGCTTACATGTCCAAAATGATGTTGATTTATTCACGCTATCAACATTTTTCTGTTTAATTCTAAGCCATCAGTAGATTTTACCAGAATGTTCTCTTCATTGCCACCCTTGAGTCTCTGTACTCCATTAACCCATTTTGAATGCCTTTATCATGTATTTGCTGCCTCCTAGTGTTTCAAAGCTGACATAATTTTTCATCTTTTTCTTTC[A/T]GGGTGGATGCTCGGGGTCTTCATGTGGTGGTTGTGACTGCAGCGGTGTTAAAGGGGCAAAGGTGGGCATGTTTTCTTCTACTTCCTGCCATATTACCTATGTTGCATCATTTAAGATCAACAATAGTAAATATCTTTATTTGTTGTGATGGAAAATCAAGGATATTCCACCAAATATTATTATCTAAACCACTAATTATTATTGTTACCACACATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCCTTCGTTCATTCGTTCATTTGTTCAATTAATCATAAATGAATGAATGAATGAATGAATGAATGAATAAATGAATGAAAGCATTATTTTATTTTAAATGTGGAAGAAATTGGATTTCTCCTTTATAGATAAAACGATTATTATCACTTTACTCAAACTCAATCCTACACAGTAGTATACACAGTAAAGAAAAATGATTAGCAAGTGATCTCCTTTCCCCACATAGCAATAAACATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27346
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Essential Splice Site 326 1601 18 50
ENSDART00000130442 Essential Splice Site 347 1644 20 52
Genomic Location (Zv9):
Chromosome 9 (position 8703200)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8683043
GRCz11 9 8661373
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAGATTGCTCAGTCTTATTATCTGTTCATCTGCTTTTAAATGTATCA[G/T]GTTTTCAAGGAGAGCCAGGAGCTCCTGGTCCCCCAGGTGAGAGAAAAAAA
Long Flanking Sequence:
ATTTCAAATACTTTGGCCACACTTATTATTTTTGAACACTTTTGTGATAGGGGGAAATCGGCTTCCCTGGTAATCCGGGACTTGATGGCTTCAAGGTAAGAAATTTCATTATTATTGTTCATGAGAGATATAAATGATTTGACCTATTTAATTTATTTTACTCACAATTTGTGTTCATTGTTCAGGGTGACAAAGGAGAAAGAGGGCCACCAGGATATGTACGTGTTATCTAAATCTATCATCTAAAACTGTACTGAACGATAACAAGTCCTATACTGCTTCTAAACATCATGCACTTAGTACAATGTCATAGACTGGTGGAAACAAATTAAAATAATTAACTTACAGGGTGCTGGTTCTCCTGGCCCTCCTGGTCCTCCAGGCCTCCCTGGAGCAGAAGGAGAAACAGGTAATGTCTGTATAATGTCTTTGTCCATATGTGGTTGTCTTTGTCAGATTGCTCAGTCTTATTATCTGTTCATCTGCTTTTAAATGTATCA[G/T]GTTTTCAAGGAGAGCCAGGAGCTCCTGGTCCCCCAGGTGAGAGAAAAAAACACTTTGATAGGATTAGGTTAGCATTTTGTAGCACTGTAGTTCACAATAATGATTCTTTCCCTTGTGATCATGATTGACTGCAGGCAGATATATCGAGGGTCCTCCTGGACCACCTGGCTTCCCTGGAGAGATTGGCAAGAAAGGAGAAAAAGGAGCCGATGGACGGTCTTTTCCAGGTCCCAAAGGAACTGATGGGCAACCTGGCCCACCCGGACCGCCAGGACCTATTAGTAAGAGCATAATAAACACAAATGATCATGTCAGGATATCAACTTGTCATAGTTTTGTTTTCAAGTGCAAAGCAAATGGCACCATGTGTGAAGAGGCTTGTGTTGTTCCATTTATTATCAAGTTCAGAGTGACACTGTGTTATTATTTTAGATGAAGAATGTGATGTTACAAAAGGAGCTCCAGGCCCTCCGGGACCTCCAGGGTTGCAAGGAGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27345
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 570 1601 25 50
ENSDART00000130442 Nonsense 608 1644 27 52
Genomic Location (Zv9):
Chromosome 9 (position 8700999)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8680842
GRCz11 9 8659172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACTGTTCTTTAGTAAAGCCCTAATCCCTAATTTTTATTTGTAGGAGCT[A/T]AAGGTGAAGCTGGTAAAGTCATAAGTTTACCTGGGCCTCAGGGTGCCCCA
Long Flanking Sequence:
CTGAAGGGAGATAAGGGCTTACCTGGTACTACTGGAGACAGAGGATTCCCGGGTGTTGATGGGCTCCCAGGAAAAGATGGACGACCAGGATATCCTGGAACCAAGGGAGAGCCTGTATGTGCTAACTCTTAGACATATGCCAATTATACTTCTCTTTTGTGTCTTTTTTTCTAGTGCACCAAGTTCTGTTGTCTCTTCTACAATATTTTATTATTCGTAGAAATGTCTGATTTATTGATTATATTTTCTATGGTTAGGCTAAATTCGGAATTAAGGGTGATCGTGGCCCAGATGGAGATTTTGGAGTTCCTGGCCCTCCAGGCGAAAGAGGTCCCCCAGGTGAACCAGGTATAGGTCGGCCAGGTCAACCTGGAGATAAGGGCTCTGCAGGATTCCCTGGTGCACCAGGAAGGCCAGGACTACAAGGTCAGTGATTTAAAGTCTAGAGGTTTACTGTTCTTTAGTAAAGCCCTAATCCCTAATTTTTATTTGTAGGAGCT[A/T]AAGGTGAAGCTGGTAAAGTCATAAGTTTACCTGGGCCTCAGGGTGCCCCAGGGCCTCGTGGAGAGAGTGGTAGACCTGGTCTTCAAGGTACATTTAATGGATATGATTGTGTCATCATTCTCAGTAACTGCAATCATTTCTACAAGGCAGAGTTGGTTGTGTTGATTTCTCTTTTGTTGCCCAGGTGATAGAGGATTTCCAGGTGAACGTGGGGTTCCAGGATTCCCTGGAGATAAAGGTGACCCTGGACTGCCAGGAATTGGACTTCCAGGACCCCCGGGGCCAAAAGGTAAACTGCAAATGCCAAACTATAACAGTCTGTTTATGATTAAAGAGGAAATGCAACTGTATCTTTTAAACTGATATCACTGCTGATAACAGATTGATATCAGTGATGTCACTTAGGTGGGACATTCTGAATAATCTGCACTTGACACTATTTTTTTTAACCGTAACCTGAGATCATTCTAAATACTAGCAATAAAACCTTGGTTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Essential Splice Site 633 1601 26 50
ENSDART00000130442 Essential Splice Site 671 1644 28 52
Genomic Location (Zv9):
Chromosome 9 (position 8700709)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8680552
GRCz11 9 8658882
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCCTGGACTGCCAGGAATTGGACTTCCAGGACCCCCGGGGCCAAAAG[G/A]TAAACTGCAAATGCCAAACTATAACAGTCTGTTTATGATTAAAGAGGAAA
Long Flanking Sequence:
GATGGAGATTTTGGAGTTCCTGGCCCTCCAGGCGAAAGAGGTCCCCCAGGTGAACCAGGTATAGGTCGGCCAGGTCAACCTGGAGATAAGGGCTCTGCAGGATTCCCTGGTGCACCAGGAAGGCCAGGACTACAAGGTCAGTGATTTAAAGTCTAGAGGTTTACTGTTCTTTAGTAAAGCCCTAATCCCTAATTTTTATTTGTAGGAGCTAAAGGTGAAGCTGGTAAAGTCATAAGTTTACCTGGGCCTCAGGGTGCCCCAGGGCCTCGTGGAGAGAGTGGTAGACCTGGTCTTCAAGGTACATTTAATGGATATGATTGTGTCATCATTCTCAGTAACTGCAATCATTTCTACAAGGCAGAGTTGGTTGTGTTGATTTCTCTTTTGTTGCCCAGGTGATAGAGGATTTCCAGGTGAACGTGGGGTTCCAGGATTCCCTGGAGATAAAGGTGACCCTGGACTGCCAGGAATTGGACTTCCAGGACCCCCGGGGCCAAAAG[G/A]TAAACTGCAAATGCCAAACTATAACAGTCTGTTTATGATTAAAGAGGAAATGCAACTGTATCTTTTAAACTGATATCACTGCTGATAACAGATTGATATCAGTGATGTCACTTAGGTGGGACATTCTGAATAATCTGCACTTGACACTATTTTTTTTAACCGTAACCTGAGATCATTCTAAATACTAGCAATAAAACCTTGGTTTGTTTGGTTAGTAAATAATGCACCAGTTCAGCAAGTAGTAGGAATTATGAATGCTTCTGACAGCGGGTTCCATTTATGATGTAGAAATCATGGTGAGGCTGATTGTAGCTCTCCATGTCAGTCAATGCTGCATTTTTTTGGACACTGCAACTAAGCCCCTAGTTGAGAATGAACATATACAATGGAACACAGTTCAGACAACCAGACACCCCAGATTAGTTTATGGCATATTAATGACTTACTGAGGTGCCTCACTGAGGCCCCGTTTACACTAGTGCGTTTTAGTTTTAAAACGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27344
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Essential Splice Site 755 1601 29 50
ENSDART00000130442 Essential Splice Site 793 1644 31 52
Genomic Location (Zv9):
Chromosome 9 (position 8697768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8677611
GRCz11 9 8655941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGAGCTCCTGGACCAATGGGGCCACCTGGAGGCCCTGGACCTATTGG[T/A]GAGATGTTTCTATTGCCTAGCACCCACACTTACATGCCCAGATGTTCACA
Long Flanking Sequence:
CTGCCTTGGTAGGCATCCCGGAGGCATCCGAAACAGATGCCCGAGCTGCCTCAGCTGACCTCTCTCGATGTGGAGGAGCAAGGGCTCTACTCCAAAACTCCTTCAGAGTGACAGAGCTCCTCACCCTGTCTATAAGAGTGTGCCCTGCCACCCTGCAAAGGAAACTCATTTCAGCCGCTTGTTTCCGAGATTTTGTTCTTTCGGTCATGACCCAAAGCTCATGACCATAGGGGAGAATAGGAACAAAGATTAGCAGTTAGGTACAGAAAGGTAGTTATATTATAATATATTATTATAGGACTGTGTATGATTGATGGCTTACACAAATGTAGGGGGTAATTAGAAGTGTTATAATAGCTCCTGATTAATTTTGTTACTTTTGCAGGTAACCCTGGACCACCTGGAGTCCATGGTGCACTAGGGCCACCAGGTCCTCCAGGACTGGGAGAACCTGGAGCTCCTGGACCAATGGGGCCACCTGGAGGCCCTGGACCTATTGG[T/A]GAGATGTTTCTATTGCCTAGCACCCACACTTACATGCCCAGATGTTCACATTTGACATAGTTTGTGACAAGTCTTGGTAATGTCCCAGGCCAGTCTGGAATAAAGGGTGACAAGGGTTATCAAGGACTACCTGGTTTGGACATGCCTGGCCCTCCAGGAGACAGAGGTAGCCCTGGTGTCCCAGGTCTACCAGGATCAAAGGGTTTGCCTGGGCAACCAGGAGTTCCTGGAAAAGATGGCTTTCCTGGCGAACGTGGTGAGTGTTTACTCCTTGCCATCTAATAAAGCCTATTAGATGCTGATTTTTTGTTGCTCAAAAGAATTCATATTTGAATTTGTTTTTCAGGTCCAAAAGGAGAAATTGGAATCATGGGAATGGCAGGACCACCAGGATTTCAAGGTTTAGTTGGAAATCCTGGAGATCCTGGGCAAAAGGGTATGTGAACACACAATAGAAACAATTTCTATCATTCATTCATTCATTTTTTTTTTCGGCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16923
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 765 1601 30 50
ENSDART00000130442 Nonsense 803 1644 32 52
Genomic Location (Zv9):
Chromosome 9 (position 8697648)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8677491
GRCz11 9 8655821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTTGGTAATGTCCCAGGCCAGTCTGGAATAAAGGGTGACAAGGGTTA[T/A]CAAGGACTACCTGGTTTGGACATGCCTGGCCCTCCAGGAGACAGAGGTAG
Long Flanking Sequence:
TCACCCTGTCTATAAGAGTGTGCCCTGCCACCCTGCAAAGGAAACTCATTTCAGCCGCTTGTTTCCGAGATTTTGTTCTTTCGGTCATGACCCAAAGCTCATGACCATAGGGGAGAATAGGAACAAAGATTAGCAGTTAGGTACAGAAAGGTAGTTATATTATAATATATTATTATAGGACTGTGTATGATTGATGGCTTACACAAATGTAGGGGGTAATTAGAAGTGTTATAATAGCTCCTGATTAATTTTGTTACTTTTGCAGGTAACCCTGGACCACCTGGAGTCCATGGTGCACTAGGGCCACCAGGTCCTCCAGGACTGGGAGAACCTGGAGCTCCTGGACCAATGGGGCCACCTGGAGGCCCTGGACCTATTGGTGAGATGTTTCTATTGCCTAGCACCCACACTTACATGCCCAGATGTTCACATTTGACATAGTTTGTGACAAGTCTTGGTAATGTCCCAGGCCAGTCTGGAATAAAGGGTGACAAGGGTTA[T/A]CAAGGACTACCTGGTTTGGACATGCCTGGCCCTCCAGGAGACAGAGGTAGCCCTGGTGTCCCAGGTCTACCAGGATCAAAGGGTTTGCCTGGGCAACCAGGAGTTCCTGGAAAAGATGGCTTTCCTGGCGAACGTGGTGAGTGTTTACTCCTTGCCATCTAATAAAGCCTATTAGATGCTGATTTTTTGTTGCTCAAAAGAATTCATATTTGAATTTGTTTTTCAGGTCCAAAAGGAGAAATTGGAATCATGGGAATGGCAGGACCACCAGGATTTCAAGGTTTAGTTGGAAATCCTGGAGATCCTGGGCAAAAGGGTATGTGAACACACAATAGAAACAATTTCTATCATTCATTCATTCATTTTTTTTTTCGGCTAAGTCTCTTTATTAATATGGGATCACCACAGCGGAATGAACCACCAACTTATCCAGCATATGTTTTAAGCAGCGGAGGATCTTCCAGCCACAACCCAACACCCATACACTCTTGCATTCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34560
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 923 1601 33 50
ENSDART00000130442 Nonsense 961 1644 35 52
Genomic Location (Zv9):
Chromosome 9 (position 8693177)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8673020
GRCz11 9 8651350
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTGACCCTGGTATGCCAGGAAAAGATGGAATGCCAGGGTCACCTGGA[C/T]AGCCAGGTTTGTCCCTAAAGCAATCATATGAAGTAAAAAAATAGTTGGAT
Long Flanking Sequence:
GTGAAATGGTCATTTTTTTCCACTTAGACTTACTTTGCATCCTGTAAATAGCGAATGCGCTTATGGCGCAACGCAGCTGGCTCTTAAAGGGAATGGGAGATGAGACTCTAATTGGTTTATTCTCAAAACACACCTATAACTCATAAAGAAAATAAACTCAACCCTTTAAGACCATGCGCCATGGCGCAAAGCAGATTTTCCCGTCCTTAAATTAACAAAAATGCGTTCTGACATGCCCTGAAAGCGTTTGCGCCCTGCGTTTTGCACTCTGCGCATGGACCGTCAAAATAGAGCCCTTGAAGTTGAAAGCCTTAATCATATATAAACCTGAGCACATTCAATTTCAGAGGCTTGTTGGGGCTCTAAAATTAAACTCATTAGACTTTGTGTTTTAACCTTGTTTTGCAGGTGATCCTGGTCCTACTGGAGAAAAGGGGTTTCCTGGAACATCTGGTGACCCTGGTATGCCAGGAAAAGATGGAATGCCAGGGTCACCTGGA[C/T]AGCCAGGTTTGTCCCTAAAGCAATCATATGAAGTAAAAAAATAGTTGGATATTAATTATCTTTATTTGATAATGTTAGTATTATGGGATCATACAGTTAAAGTCTGAATTATTAGCCTCCCCTTTATTTTTTATTTTTGTAATATTTCTCAAATGATTAACAGAGCAAGAAAATTTCACAGCATTTCTGATCATACTTTTTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTCTGCTAAAATAAAAGCAGTTTAAAAATTTTTAAAAACCATTTTAAGGTCAAAATTATTAGCCCCTTTAAGCTATATTTATTTCGATAGTCTATAGAACAAACCATTGTTATACAATAATTTGCCTAATTACCCTAACCTGCCTGGTTAACTGAAAAAAAAAAAAAAAACTAGTTAAGCCTTTAAATATCACTTTAAGCTGTATAGAAGTGTCTTGAAAAATATCTAGTAAAATTTATTTACTGGCATCACGCAAAGGTAAAATAAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27343
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 1073 1601 38 50
ENSDART00000130442 Nonsense 1115 1644 40 52
Genomic Location (Zv9):
Chromosome 9 (position 8691276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8671119
GRCz11 9 8649449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGATGGTGAAAATCCTAATGGCATTTTTGTCTAGGTGAGCCTGGTCTA[C/T]AGGGTCCTCCAGGTCCCCATGGGGAAAAAGGTCAATCAGGGCAAGATGGC
Long Flanking Sequence:
TTCAAACTTTAAGGGAAATATAGGCTCCCCTGGATTCCCTGGTGAGCCTGGAGAGAAGGGACAGAAGGGTACAATGGGTATGACAGGAACTCCTGGAACTCAAGGACATAAAGGAGACCAAGGATCGATTGGTTACCCAGGCAAGATACACAGCATGTGTTATTAGTTCACTCATGCTATAATACAGTGCTTTGCTATAATGAACTATAATGTACAAATCATATTGTATCCTGGGCAGGCAGTCCAGGGAAGCCTGGTGAGAAAGGTGTTGGTGGGTTGCCAGGGTCCCCAGGAGAACCTGGGACTCCAGGACGTCCAGGTAAATCCGTTTATCCATTTTAATGCACATTATGCTAAAAGTAGTACCCTTCCTACAAAAAACAAAACAAGTGTAAATGACATTAAAGATGCATTACTGTACGCTTCAGAAAAGTCACACTGTACTTCACATTTGATGGTGAAAATCCTAATGGCATTTTTGTCTAGGTGAGCCTGGTCTA[C/T]AGGGTCCTCCAGGTCCCCATGGGGAAAAAGGTCAATCAGGGCAAGATGGCATTCCTGGATTCACTGGAGAGAGAGGGGAGCCTGGTAAGATTCTTTAGCTCTGAAGGTGAAATTATGTTATTTTCAATGCTCAGGTTATAACACACCTTCTATGACTGTTTTATATAAGTTAAATATCCACACATAAACATTTTGCTATAAATTGTTAATAAGGGCATTTATAATAACACTTTTTTGTATGTCTATGATTAAATTTTAATATGCATTAATATTAACTTTTTAATGTATCATCATTTGTTTGTCAAAATGTTTATACACAGTATTAACTACACATTTTGGTCATATACATGGTTAGTGAAAGAAACCCATTAACCTAAAGACAAACAATTGTTCTTCTTCAGGTGTACCAGGGAGAGGTTTGCCCGGATCTCGTGGAGAACCTGGCGGCAAAGGTTAGAATCAGATCCTCAATAATTACGATCTGTTTAAAGCCAATGTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27342
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 1107 1601 39 50
ENSDART00000130442 Nonsense 1149 1644 41 52
Genomic Location (Zv9):
Chromosome 9 (position 8690856)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8670699
GRCz11 9 8649029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACCTAAAGACAAACAATTGTTCTTCTTCAGGTGTACCAGGGAGAGGTT[T/A]GCCCGGATCTCGTGGAGAACCTGGCGGCAAAGGTTAGAATCAGATCCTCA
Long Flanking Sequence:
CGCTTCAGAAAAGTCACACTGTACTTCACATTTGATGGTGAAAATCCTAATGGCATTTTTGTCTAGGTGAGCCTGGTCTACAGGGTCCTCCAGGTCCCCATGGGGAAAAAGGTCAATCAGGGCAAGATGGCATTCCTGGATTCACTGGAGAGAGAGGGGAGCCTGGTAAGATTCTTTAGCTCTGAAGGTGAAATTATGTTATTTTCAATGCTCAGGTTATAACACACCTTCTATGACTGTTTTATATAAGTTAAATATCCACACATAAACATTTTGCTATAAATTGTTAATAAGGGCATTTATAATAACACTTTTTTGTATGTCTATGATTAAATTTTAATATGCATTAATATTAACTTTTTAATGTATCATCATTTGTTTGTCAAAATGTTTATACACAGTATTAACTACACATTTTGGTCATATACATGGTTAGTGAAAGAAACCCATTAACCTAAAGACAAACAATTGTTCTTCTTCAGGTGTACCAGGGAGAGGTT[T/A]GCCCGGATCTCGTGGAGAACCTGGCGGCAAAGGTTAGAATCAGATCCTCAATAATTACGATCTGTTTAAAGCCAATGTATGCTTCTGCATCGAGTCCACATAGTAGGTTCAACATAGCCTTTTTATTTCTCCAAAAATGTAGTGAGATTTATTTTTTAATCTCAATTTAATCTCAAGTACTAATTTCGAGAGGATCACATGCTTATGATTAACCACAGCTGGTCCTGCATTAGCTATCATACCTGTATGATTTACCAATCCTTCATTTACTAATTTTTTTTGGCTTAGTCCCTTTATTATTCTGGGGTCACCCCAGCGGAATGAATCGCCAACTTATCCAGCACATGTTGTACCCAGCGGATGCCCTTCCAGCTGCAACCCATCACTGGGAAACACTCATACACTCTCATTCACACACATACACTATTGACAATTTTAGCTTACTCAATTCACCTGAATCGCATGTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45346
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 1152 1601 40 50
ENSDART00000130442 Nonsense 1194 1644 42 52
Genomic Location (Zv9):
Chromosome 9 (position 8689211)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8669054
GRCz11 9 8647384
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAACCAAAGGTGATAAAGGTCTGTCAGGATTGCCAGGGGATCAAGGT[C/T]GACCTGGGGAGAGAGGACTTCCAGGACAAGCCATGGAGGGGCCTAAAGGG
Long Flanking Sequence:
GAACCCACTAGGCTACTTTGTCACTCATCTATAAAGGAGGGGAGTAGAGGCAGGCAGGGTTTTTGTTCAAGACAAAGATACTGAGATAAGAAACTAATAATTTATAGTGAGTTTGGAATCATCTGATAAAGCTAATGAGGGACCAGCCGTGAACAATCATAAGCACGTGATCCTCTTGAAATTAATTTATAAATAAACTTCACAAATGCTCATAAGGACGTTGTCTATGTGCAAAGTATGCGCTGTAGGGTATGTCGATCACTCAACACAGATTTATAAATCATGCTTAAGAATGACTTAAGAATGACTAAATTTTAGTTAATTATTTTTAATTAACACCGTATTATCACAAGTAATTAAATCGGATCGTTAGTAATTAATAAAATGTCTCCACACCAGGTGACAAAGGCAACCCTGGTCTTCCTGGCATTCCCGGGAGTCCAGGTATACCTGGAACCAAAGGTGATAAAGGTCTGTCAGGATTGCCAGGGGATCAAGGT[C/T]GACCTGGGGAGAGAGGACTTCCAGGACAAGCCATGGAGGGGCCTAAAGGGGACAGAGGAGACCAGGGACAGCCAGGAGAAAGAGGTGAAGCCTAAACACTTTCACATTTACATGTTTGATGCACACTTCATGTTATTTGCAAAAGCTTGCTTTTTCTGGAAAATCTGAAAATTGTTTTATGAGATTAATTGAGCAAATGCTACCCATTACAGCATAACAAGGGAATCTACAGGGACTCTACAGTAATGCAACAGTCACCAAAAGGCCACAATTTAGATCAAAGCCTAAAAAGGGCAGTTTCAAAAGAGTTATTATCAATATTTGTGGCGTATTTTGAGCTAAATTCACATACACACTCTAGGGCAGGGGTGTCCAAACTTTTTAGCACGAGGGCCAGATGCAAAAAAAAAAAAAAAAAGTTGTCCCGGGCCAAATTTGTGTGTGTGTATTATGGAATTCTTTATTTTTATTATTTTTTTAAGATTTATTTTTGGCCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34559
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 1502 1601 48 50
ENSDART00000130442 Nonsense 1545 1644 50 52
Genomic Location (Zv9):
Chromosome 9 (position 8680850)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8660693
GRCz11 9 8639023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCTATGGTTATAGCTGTGCACAGTCAGACCATACAAATTCCAAACTG[T/A]CCCGATGGCTGGGCTTCACTCTGGATTGGATACTCTTTCGTTATGGTGAG
Long Flanking Sequence:
CACTCCTGTTCTTTGTACCCTGTAGGTACAGCTGGTAGTTGCCTAAGGAAGTTCAGCCCAATGCCGTTCCTCTTCTGTAACATCAACAATGTTTGCAACTTTGCATCTCGTAATGACTATTCCTACTGGCTGACCACTCCAGAGCCCATGCCTATGAGCATGGCCCCCGTCACCGGCGAGAGCATCAAACCCTTCATCAGCAGGTCTGTGATATTTATTAATTAAAATTTCTATTGTATTCTATTGACTTTTATTGTGTTTTTATTTAAACTGATTGTTCTAGCTGTCCTGTACGGTAACCTTGAGTGCCAAGAAAGGTGCCTTTAAATAAAATGCATTATTATTGTTATTATGAAAGTTTGATATATCCACGAGTGAGTGTTCTTAGTTCCCATGTACAGTATACAGTATGTGTCTTTTTTCTGTGGCAGATGTGCTGTGTGTGAGGCTCCTGCTATGGTTATAGCTGTGCACAGTCAGACCATACAAATTCCAAACTG[T/A]CCCGATGGCTGGGCTTCACTCTGGATTGGATACTCTTTCGTTATGGTGAGAAAACCAGATAAATTAAAACAAAATCGACTAATTAAATAATGTGAATGCACAAACTGTAAATGTAAATAAATACACTGCTCTTTCCAATTATAGTTTTTTTAAGAGCTCAGAACATATTGGTTTATTTCATGTGAATAAAGCAGCTGAAATATTGCATCTTGAGCTGCACAAGTGTAAGTAAACACAGTGCTGTGCTTCACTACAAATATATTTATTTAATTTACAAAAAAATAAAACATTGAAATAGTAAAAAACTAAATATAGAGCAATAGAGTATAGCACAGTAAAAAAATAAAGATTTGTAGATGTTAGTACTGCAAATTTACAGTTGAATTACACAATAAAATAGTTTATTATTTTTTATTAACTACTTTTTATTACATAGTAAAATAGTAGGTCACACTTTATTTTGATGGTTGTTTGTTGAATTTAAGTTACATTGCATCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8330
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Essential Splice Site 1517 1601 48 50
ENSDART00000130442 Essential Splice Site 1560 1644 50 52
Genomic Location (Zv9):
Chromosome 9 (position 8680803)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8660646
GRCz11 9 8638976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTCCCGATGGCTGGGCTTCACTCTGGATTGGATACTCTTTCGTTATGG[T/C]GAGAAAACCAGATAAATTAAAACAAAATCGACTAATTAAATAATGTGAAT
Long Flanking Sequence:
GAAGTTCAGCCCAATGCCGTTCCTCTTCTGTAACATCAACAATGTTTGCAACTTTGCATCTCGTAATGACTATTCCTACTGGCTGACCACTCCAGAGCCCATGCCTATGAGCATGGCCCCCGTCACCGGCGAGAGCATCAAACCCTTCATCAGCAGGTCTGTGATATTTATTAATTAAAATTTCTATTGTATTCTATTGACTTTTATTGTGTTTTTATTTAAACTGATTGTTCTAGCTGTCCTGTACGGTAACCTTGAGTGCCAAGAAAGGTGCCTTTAAATAAAATGCATTATTATTGTTATTATGAAAGTTTGATATATCCACGAGTGAGTGTTCTTAGTTCCCATGTACAGTATACAGTATGTGTCTTTTTTCTGTGGCAGATGTGCTGTGTGTGAGGCTCCTGCTATGGTTATAGCTGTGCACAGTCAGACCATACAAATTCCAAACTGTCCCGATGGCTGGGCTTCACTCTGGATTGGATACTCTTTCGTTATGG[T/C]GAGAAAACCAGATAAATTAAAACAAAATCGACTAATTAAATAATGTGAATGCACAAACTGTAAATGTAAATAAATACACTGCTCTTTCCAATTATAGTTTTTTTAAGAGCTCAGAACATATTGGTTTATTTCATGTGAATAAAGCAGCTGAAATATTGCATCTTGAGCTGCACAAGTGTAAGTAAACACAGTGCTGTGCTTCACTACAAATATATTTATTTAATTTACAAAAAAATAAAACATTGAAATAGTAAAAAACTAAATATAGAGCAATAGAGTATAGCACAGTAAAAAAATAAAGATTTGTAGATGTTAGTACTGCAAATTTACAGTTGAATTACACAATAAAATAGTTTATTATTTTTTATTAACTACTTTTTATTACATAGTAAAATAGTAGGTCACACTTTATTTTGATGGTTGTTTGTTGAATTTAAGTTACATTGCATCTACATGCCAACTAATTCTCATTAGATTATAAGTAGACTGTTAGGTTGGGG
Associated Phenotype:
Not determined