Busch Lab

ZMP

Q1RLV8_DANRE

Ensembl ID:
ENSDARG00000054984
Description:
LOC573743 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLV8]
Human Orthologue:
ZBTB41
Human Description:
zinc finger and BTB domain containing 41 [Source:HGNC Symbol;Acc:24819]
Mouse Orthologue:
Zbtb41
Mouse Description:
zinc finger and BTB domain containing 41 homolog Gene [Source:MGI Symbol;Acc:MGI:2444487]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25102 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9876 Nonsense Available for shipment Available now
sa14303 Essential Splice Site Available for shipment Available now
sa16227 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25102
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Essential Splice Site 357 733 4 10
ENSDART00000108841 Essential Splice Site 457 833 5 11
Genomic Location (Zv9):
Chromosome 2 (position 13597103)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14081762
GRCz11 2 13764679
KASP Assay ID:
554-7691.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAGTCACGGTTTGCCAGGCTAAAGCACCAAGAAAAGTTCCATTTAGG[T/A]AAAGTTTTCCTAAAACCATTTTTCTGAATGTGTTGTTTTTCTTGTTTCAT
Long Flanking Sequence:
TAATTTAATGCATTTACTTGCTGCAGTTCACAATATATATTCAGGCTTGTTTTTTGGCTTTGGAATTCTTTATTGTTTAAGCATGAAACATGTTGTCTGCTAACAGATTTCATCCTGACCACCTGCAGGAGTTTCTCACTCAGAAGAAGAAGAGTGAAGTGTGGAAATGTGATGTGAGTCATATGCCTTATTTATTCTTTGTTATTTTATATGCATTTTTAACATGTTATTAATATATGCCAATTGCCACAGAATGCCATAAAGTTTTAACTAAATTCTGTTTGTGAACACTTTTCATTTGTCTGCAGTTAGTCTAAATTTGTCATTTTGTTTTTGTTGCATCTTTTGCAGATCTGTCACAAGTCCTTCAGCCGTCGCCCCCACCTGGAGGAGCACATGATCTTACATTCACAGGATAAACCCTTTAAGTGTGCCTACTGTGATGACTACTTTAAGTCACGGTTTGCCAGGCTAAAGCACCAAGAAAAGTTCCATTTAGG[T/A]AAAGTTTTCCTAAAACCATTTTTCTGAATGTGTTGTTTTTCTTGTTTCATCTCTGTTCTGTGGTGTGAATGCACCAAAAAGTTGAAGTCTTATTCAGCTCAAAACATTCTTTTAATGTTCACAAAATGTCCATAATTCAGGACCATTCCCTTGTGACATCTGTGGTCGTCAGTTTAATGACACAGGCAACCGCAAACGTCATATAGAGTGCACACATGGGGGAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTTCGAGAGAGGTGAGAGAAGTTGCTTTTATTCTCAATCTTTAGTCATGTTTCCATCCAAAGATGCAAACGTTTTATGTGAATATATCTAATTTGTATCTAAAGCACCATTTCCATTACCATTTTGTTTCATTTTAGAATGATCTAAACAACATTTCAGACGTTGTGCTATGTGGGTCCGTCCACTGGTTTGTCCATAAATGCCATCCCATTGTGCATATTTTTGTTATCACATGGTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9876
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Nonsense 384 733 5 10
ENSDART00000108841 Nonsense 484 833 6 11
Genomic Location (Zv9):
Chromosome 2 (position 13597324)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14081983
GRCz11 2 13764900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTAAWGACACAGGCAACCGCAAACGTCATATAGAGTGCACACATGGG[G/T]GAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTTCGAGAGAGG
Long Flanking Sequence:
ACATGTTATTAATATATGCCAATTGCCACAGAATGCCATAAAGTTTTAACTAAATTCTGTTTGTGAACACTTTTCATTTGTCTGCAGTTAGTCTAAATTTGTCATTTTGTTTTTGTTGCATCTTTTGCAGATCTGTCACAAGTCCTTCAGCCGTCGCCCCCACCTGGAGGAGCACATGATCTTACATTCACAGGATAAACCCTTTAAGTGTGCCTACTGTGATGACTACTTTAAGTCACGGTTTGCCAGGCTAAAGCACCAAGAAAAGTTCCATTTAGGTAAAGTTTTCCTAAAACCATTTTTCTGAATGTGTTGTTTTTCTTGTTTCATCTCTGTTCTGTGGTGTGAATGCACCAAAAAGTTGAAGTCTTATTCAGCTCAAAACATTCTTTTAATGTTCACAAAATGTCCATAATTCAGGACCATTCCCTTGTGACATCTGTGGTCGTCAGTTTAATGACACAGGCAACCGCAAACGTCATATAGAGTGCACACATGGG[G/T]GAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTTCGAGAGAGGTGAGAGAAGTTGCTTTTATTCTCAATCTTTAGTCATGTTTCCATCCAAAGATGCAAACGTTTTATGTGAATATATCTAATTTGTATCTAAAGCACCATTTCCATTACCATTTTGTTTCATTTTAGAATGATCTAAACAACATTTCAGACGTTGTGCTATGTGGGTCCGTCCACTGGTTTGTCCATAAATGCCATCCCATTGTGCATATTTTTGTTATCACATGGTCTTAAAAAACGTTTTTCTTTTTGTTTTGTTTTTATGTGCATGCAGGAATTTATTTGATAAATGTGTTTCGTTGTTGTTCATGCACATTTTTTCTTGTTTCGTATTTTTTTCTTAGGTTTATCTAACTCAGTTGTGTGCAAACGTTGTTTTATTATGTGCATTTTTTTATTTAATGTGCATCTTGGCATTTCTATTGAAAATATTTCAAAGTGTGCATAAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14303
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Essential Splice Site 400 733 5 10
ENSDART00000108841 Essential Splice Site 500 833 6 11
Genomic Location (Zv9):
Chromosome 2 (position 13597375)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14082034
GRCz11 2 13764951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTWCGAGAGAGG[T/A]GAGAGAAGTTGCTTTTATTCTCAATCTTTAGTCATGYTTCCATCCAAAGA
Long Flanking Sequence:
AAATTCTGTTTGTGAACACTTTTCATTTGTCTGCAGTTAGTCTAAATTTGTCATTTTGTTTTTGTTGCATCTTTTGCAGATCTGTCACAAGTCCTTCAGCCGTCGCCCCCACCTGGAGGAGCACATGATCTTACATTCACAGGATAAACCCTTTAAGTGTGCCTACTGTGATGACTACTTTAAGTCACGGTTTGCCAGGCTAAAGCACCAAGAAAAGTTCCATTTAGGTAAAGTTTTCCTAAAACCATTTTTCTGAATGTGTTGTTTTTCTTGTTTCATCTCTGTTCTGTGGTGTGAATGCACCAAAAAGTTGAAGTCTTATTCAGCTCAAAACATTCTTTTAATGTTCACAAAATGTCCATAATTCAGGACCATTCCCTTGTGACATCTGTGGTCGTCAGTTTAATGACACAGGCAACCGCAAACGTCATATAGAGTGCACACATGGGGGAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTTCGAGAGAGG[T/A]GAGAGAAGTTGCTTTTATTCTCAATCTTTAGTCATGTTTCCATCCAAAGATGCAAACGTTTTATGTGAATATATCTAATTTGTATCTAAAGCACCATTTCCATTACCATTTTGTTTCATTTTAGAATGATCTAAACAACATTTCAGACGTTGTGCTATGTGGGTCCGTCCACTGGTTTGTCCATAAATGCCATCCCATTGTGCATATTTTTGTTATCACATGGTCTTAAAAAACGTTTTTCTTTTTGTTTTGTTTTTATGTGCATGCAGGAATTTATTTGATAAATGTGTTTCGTTGTTGTTCATGCACATTTTTTCTTGTTTCGTATTTTTTTCTTAGGTTTATCTAACTCAGTTGTGTGCAAACGTTGTTTTATTATGTGCATTTTTTTATTTAATGTGCATCTTGGCATTTCTATTGAAAATATTTCAAAGTGTGCATAAAAAATAGGTGGATGGAAGCATAATTGCATAATTATATAAACTGTTTGCAAATGTTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25780
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Essential Splice Site 532 733 9 10
ENSDART00000108841 Essential Splice Site 632 833 10 11
Genomic Location (Zv9):
Chromosome 2 (position 13620495)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14105154
GRCz11 2 13788071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTTCAGGGGGAAAACCAACCTCATGTCACACTTCAGAACACATTCAG[G/A]TACAGCATATTATTATTTAAAAGACTTCAAAAATGTTGTTTTGAGCACTG
Long Flanking Sequence:
TCAACACACGTAGAGGAATGACAATAAAGGTCGACTAGACTTAACTTGATGTGGCCGGCGGATCCCAAGTTGAAATTTGAAAATGAACTGTAACCACTTATTCTCACAGCTTTGCTCAAAACATAAATGTATGTTAATAGTCTTATCTGCTTTGTGTAGGGGAAAAAGCACACCAGTGTGAAGAGTGTGGAAAATGCTTCCGACGTGCCGATCACTTGACCGTCCATTACAAAAGCATTCACCTGGGAGAAAAGATATGGCAAAGGTATGTGCAAACACACATCAATTTAAAAACAAAAAGGCACATTTTGTAAAAATTATTTGATATAATAAAAATAAAAATTCCGTAGTTGAATTTTAGTGTCTGAGAACTGTAATTCCATGCCTGCTATGTTCTCAATAATTTTACAGGTATAAAGCAGTAGTGCATCAGTGTCAGGTGTGCAAGAAAGAGTTCAGGGGGAAAACCAACCTCATGTCACACTTCAGAACACATTCAG[G/A]TACAGCATATTATTATTTAAAAGACTTCAAAAATGTTGTTTTGAGCACTGTAATGAAGTAAAATAATAAACTTAATGATCAAATTAAACAAAAATAAAAACAAATGCTATATATATAAGGTATTTGGTATTTCTAATGCATTCATTTGGAAGATCTCACACAGTTCATTATGGGATTGAAAGCGAGACAGTAAGCAGTGAGAACAGCAGAAAAGTTGGGCAGTCAAATTTATATAAATGTTATATACCCCACTGACTCTTTTTCATTTTGATATTAACAGCTTAAACCGACAGCAAATGTTGAGGCACACTAAATATTTATTTGAATAACTTATTTAATATGGTCATTATAAAAGTATATAGTACAATAAATGTATACAATATATAGGAAATAGGAATTAAACTAAAATGTTTTAGTGTAAATGGAACCTAAATACAGTTTAATGCGAAGATGCTTGTCTGATAGGATGTCAGAATGGGTCTATTGTTAAGCTCATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16227
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Nonsense 577 733 10 10
ENSDART00000108841 Nonsense 677 833 11 11
Genomic Location (Zv9):
Chromosome 2 (position 13632733)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14117206
GRCz11 2 13800123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGATGTACGTCCTTTCAACTGCCCACACTGCAGTGCTACCTTCAAGCGT[A/T]AGRACAAGCTCAARTATCACRTTGATCATGTGCACAGTGTTCRTCTGCTT
Long Flanking Sequence:
CTCTTGCCCCCCCATAGCACCAGGCCTGTGTATGAATGAGCTTAACAGAGGAGAAAAGTCAGAGTTTAGCAGCTGTTGAACATGTGCACCTGCACTACAGAGAAAGGAAGGCTTTGACAACTTTCATTCTTAGTTGTTATGGTTACTACTAATGTTTGCAGTTATTTAAAATTGATCAAAACTGACTGGAACTACATGTACATTTCAGCAAATTTAATGCATGGCCTTCAGCCAGAATTTCAATAGACCCTGATTGTAATTGTAATGACAATTGAGAGATGTACAGTGTCTCAAAAATCCTGATGTATCGTATTTTAAACATTTTAACATGATTTTTCTTTTTCTGATTGAATATTTTGTTCTCCTTAGGTGAGAAACCCCACAAGTGTGTGATCTGTAACCAGACGTTCAGCATCAAGAAAACTTTGACCAAACACATGGTTATTCATTCAGATGTACGTCCTTTCAACTGCCCACACTGCAGTGCTACCTTCAAGCGT[A/T]AGGACAAGCTCAAGTATCACGTTGATCATGTGCACAGTGTTCGTCTGCTTGACCAGCAGCAGAATCAGCCTGCCAGCCCTGCTAACAAGTTAATCGACCCATCACTGTCAAATAAAAATTCCAAACCATGTCAAAATGCATCTAAGACTGTGCTGCAGAGTGTGGCAGCTGATGTTTGTGTTCCTGTGACACTCATTCCTGTACAGATGACTGAGGAAGCTGATCTTGCTGTTCATGGAGTGCCACATGGCATTCTTCCTGCTTTAAGCCAGCCACAGCAGAGCTACCAGTCTGCCACTGACTTAGTATTCTTGGAAAAATACACTCTCACACCTCAGCCAACCAATATAGTGCATCCAGTGCGAGTAGAACAAATGCTGGACCCTCGAGAGCAGTCTTACCTAGGCACACTTCTGGGACTGGACTCAGCTACACCTGTACAAAACACGTCTAGTGCTGAACATACTCAATAAATTGTCATATGCATGTCTTTGTGTGAT
Associated Phenotype:
Not determined