Busch Lab

ZMP

si:ch211-160j6.2

Ensembl ID:
ENSDARG00000054978
ZFIN ID:
ZDB-GENE-030131-3724
Description:
Novel kinesin motor domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LXY1]
Human Orthologue:
KIFC3
Human Description:
kinesin family member C3 [Source:HGNC Symbol;Acc:6326]
Mouse Orthologue:
Kifc3
Mouse Description:
kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa644 Essential Splice Site F2 line generated Not yet available
sa29094 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa644
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077251 None None 937 None 20
ENSDART00000132184 None None 690 None 13
ENSDART00000138075 Essential Splice Site None 88 2 4
ENSDART00000138511 Essential Splice Site None 115 2 4
ENSDART00000140357 Essential Splice Site 102 140 2 2
ENSDART00000145288 None None 753 None 16

The following transcripts of ENSDARG00000054978 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 43975659)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45564714
GRCz11 18 45561668
KASP Assay ID:
554-0553.1 (used for ordering genotyping assays)
KASP Sequence:
AGGRCACCGATGTTGATATATCTTGTATGTTTCTGCTCTGTGTGTGCGCA[G/A]CCCGTCCAGCGGTGTGGTCTGCTCGGCCCTGCGGTCATGTACGGCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29094
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077251 Essential Splice Site 347 937 7 20
ENSDART00000132184 Essential Splice Site 134 690 2 13
ENSDART00000138075 None None 88 None 4
ENSDART00000138511 None None 115 None 4
ENSDART00000140357 None None 140 None 2
ENSDART00000145288 Essential Splice Site 134 753 2 16

The following transcripts of ENSDARG00000054978 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 43988300)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45577355
GRCz11 18 45574309
KASP Assay ID:
2261-2591.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACGACGAGGACACACTGCGTCGACACACTACAGTGCCACAGGTCAAG[G/A]TGACATAATAATGATATTGATAGTCATTTCAAAGCCTGTGCATTATAGAG
Associated Phenotype:
Not determined