Busch Lab

ZMP

cd40

Ensembl ID:
ENSDARG00000054968
ZFIN ID:
ZDB-GENE-090313-95
Description:
CD40 antigen [Source:RefSeq peptide;Acc:NP_001138718]
Human Orthologue:
TNFRSF11A
Human Description:
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
Mouse Orthologue:
Tnfrsf11a
Mouse Description:
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6751
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077243 Nonsense 104 286 4 9
ENSDART00000137358 Nonsense 17 126 2 6
Genomic Location (Zv9):
Chromosome 23 (position 37921358)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37896696
GRCz11 23 37828133
KASP Assay ID:
554-5408.1 (used for ordering genotyping assays)
KASP Sequence:
ATGAATTCAAACAAGACCAGCCGAAATGAATGCCAGTGTAAGCCCGGATA[T/G]TACTGTGATCTAGATCATGGATGCGAGGTTTGTCGGAAACACACAGTCTG
Associated Phenotype:
Not determined