Busch Lab

ZMP

alg1

Ensembl ID:
ENSDARG00000054963
ZFIN ID:
ZDB-GENE-030131-6093
Description:
chitobiosyldiphosphodolichol beta-mannosyltransferase [Source:RefSeq peptide;Acc:NP_956161]
Human Orthologues:
ALG1, ALG1L
Human Descriptions:
asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae) [Source:HGNC
asparagine-linked glycosylation 1-like [Source:HGNC Symbol;Acc:33721]
Mouse Orthologue:
Alg1
Mouse Description:
asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31333 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31333
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077235 Nonsense 140 488 3 13

The following transcripts of ENSDARG00000054963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 29012112)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 28730151
GRCz11 3 28860993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGTATATTTCAAAGGTGATACTCCAGTCTTTCCAGCTGCTCTATGTCT[T/A]GATGACGATTGAAGACCAAGGCTATATTCTTATGCAGGTATCGGTCTCAT
Associated Phenotype:
Not determined