Busch Lab

ZMP

zgc:110540

Ensembl ID:
ENSDARG00000054929
ZFIN ID:
ZDB-GENE-050327-77
Description:
deoxycytidine kinase [Source:RefSeq peptide;Acc:NP_001014374]
Human Orthologue:
DCK
Human Description:
deoxycytidine kinase [Source:HGNC Symbol;Acc:2704]
Mouse Orthologue:
Dck
Mouse Description:
deoxycytidine kinase Gene [Source:MGI Symbol;Acc:MGI:102726]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14961 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29603
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009889 Essential Splice Site 70 264 2 7
Genomic Location (Zv9):
Chromosome 21 (position 25882583)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26452401
GRCz11 21 26489096
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCCATAGGGAAATGGTGCAATGTACAGACCACAGAGAATGAATATGAG[G/A]TACAGTAAATCTAAGATTTGATTTTAAATAAATAAAACAACACTTTTTTC
Long Flanking Sequence:
GATGTTACAAAGCCATGCCAAACACCTGTATAAAATATAACTAATAATCAACATCAAATGGCCTAATTTTTTTTACCTTAACTTTGTCTCTGCATCCAGTTTGAAATGTATAAAATGCTTGGTTTTTGTGTATTAAATTTATAATAGTTTGTACCTTTCATGTAAGTGAAGCTAATATGACAATAGACTTGCACAACAGAAACACAACTGCATGATATTTTATTAAACTGTTAAACTTACACAAAGTTTTATTTAAGGATGTTTCAGCCAATTCATGAAATATTTAACTATCTAGGGGATTTGTTTTAGTCTGTAATAATAAGGTGCACCGCATGTTGTACATTTTTTGTTTTGCATTTTAAAACATTTATATCTGTTCAACAGCGGCAGGAAAGTCCACTTTCGTACGTTTGTTAGAGCGGGCATCAGAGGAATGGGAGGTCATACCAGAGCCCATAGGGAAATGGTGCAATGTACAGACCACAGAGAATGAATATGAG[G/A]TACAGTAAATCTAAGATTTGATTTTAAATAAATAAAACAACACTTTTTTCAAGTGTTCAAATAACAAGTTTTCCTTTGTTGTTTTGAAAGCTTTTGTTTACAAATTAAATATCCATGACTGAAATCGCTGTATCATGCCAGGCCATTAGTTGGAAATGACACTTTGTAAAGAAGCATACACAGACTGATTATGCAATTTGTATGTGTATATCAGAAATGCACATTAGTCTGTGCATCTAGTAATGTAGATGTTATATAGTAGTTATAAATTAGTCTGTTGTTTTCTTTAAATTCTAATAGTATAAACTTTAGAAAGTAATACTTTAAAAACCCAGTTTTAGATCCCTAAAACACCACAGTCATGTACAGTTGAAAGCAAAATGATTACCCCTCCAGTGAAATTTGTATTATTTTTAAAAGATTTCCCTAAGTGATGTTTAACAGACATTTCACAGTATTTCCTATAATATGTTTTTCTTATGGAGAAAGTCGTAATGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14961
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009889 Nonsense 195 264 5 7
Genomic Location (Zv9):
Chromosome 21 (position 25880597)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26450415
GRCz11 21 26487110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTATATGCATGATCTGCAGAGGTGTATGCAGCGGCTTCAGTTTAGAGGA[C/T]GAGAAGAGGAGCAGGGGATTCCTCTGGACTATTTGGAGAAGCTGCATTAT
Long Flanking Sequence:
ATACGACAAGCCGAGTCGCTGGTCCTACACTTTCCAGACCTACGCCTGTCTGAGTCGAGTCCGTTCGCAGCTTCAGCCTCCATCTGCCAAACTTCAGCAGGCAGAGAAGCCAGTCCAGTTCTTTGAGCGCTCCGTCTACAGTGACCGGTACATATAAAAAGAGTCATGAAAAACAGCTACCAAAGAATGCCATTTAACTGAAAAGCTTGATATTTGCAAATCTCCAGATACGTGTTCGCCTCCAATCTCTTTGAGTCCGGAGATTTGAATGAGACCGAATGGGCCATTTACCAAGACTGGCATTCATGGCTTCTCACTCAGTTTGAGTCGCAGATTGAACTGGATGCCATGATCTATCTTCGGGCTGATCCTGAGGTATCTTGCAGCTCATTATGTGATACACCTGTAGTAACATGGAAATGATGGAATAAATGTTAGGATGGTTGACTGATTATATGCATGATCTGCAGAGGTGTATGCAGCGGCTTCAGTTTAGAGGA[C/T]GAGAAGAGGAGCAGGGGATTCCTCTGGACTATTTGGAGAAGCTGCATTATAAGCACGAGTGTTGGCTGTACAACCAAACCACAAAGTTAGTGATTGGCTTATTATTAGGTGCTAAAACCTGCATTTGAGCTGTTTGAATTTCTTCCAAGACATTTAAAGAGATGAAGCCACTCAAGGACAACACATACACTTAATACACTTCATTAAACATGCACACATAGACATCGTCATCAATAATAGATGCTGGTATATTTATATAATAACTTACATTTGATTGTAGCTTTGACTTAATTTAATTGTAATGCATCTTTCATAAAGCTGCTTTGAAAGAACAATCATTGTAAAAAGCGCTGTACACATAAACTTGAATTGATATCTTGTCTTATGCAGGTTGGACTTTGAGTATCTAAAAGACCTTCCCATCCTGATCCTGGATGTTAATGAGGATTTTAAAAATGACAGAATTAAACAGGAAGGTGTAATTGATAAGGTATGTATAT
Associated Phenotype:
Not determined