Busch Lab

ZMP

bcas3

Ensembl ID:
ENSDARG00000054893
ZFIN ID:
ZDB-GENE-040426-1257
Description:
breast carcinoma amplified sequence 3 [Source:RefSeq peptide;Acc:NP_956916]
Human Orthologue:
BCAS3
Human Description:
breast carcinoma amplified sequence 3 [Source:HGNC Symbol;Acc:14347]
Mouse Orthologue:
Bcas3
Mouse Description:
breast carcinoma amplified sequence 3 Gene [Source:MGI Symbol;Acc:MGI:2385848]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa423 Essential Splice Site Available for shipment Available now
sa35899 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa423
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Essential Splice Site 328 805 12 21
Genomic Location (Zv9):
Chromosome 15 (position 26334065)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27065432
GRCz11 15 26998308
KASP Assay ID:
554-0370.1 (used for ordering genotyping assays)
KASP Sequence:
TATTTATGTGGCTTCGTCAACTTACTGTAGCTTTATTGTGTGTATGTTTC[A/T]GGTTCTTGTTAGTGAGGATTCTGATGGCGAAGGACTGATTGCACATTTTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4611
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Nonsense 530 805 15 21
Genomic Location (Zv9):
Chromosome 15 (position 26387233)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27118600
GRCz11 15 27051476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCTTCGTTACCCAGTTTGACGGTTGTGCTACCACTGGCTCAGATCAAA[C/T]AACCCATGACCTTGGGCACCATCACMAAGCGCACAGGGTGAGTTTCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35899
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Essential Splice Site 706 805 19 21
Genomic Location (Zv9):
Chromosome 15 (position 26419093)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 27150460
GRCz11 15 27083336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGGCCTCTGATCACAGTGGTCAGGAGGATGAAGAATGGCTCTCACAGG[T/C]GAGTTAGAACCGTGATCTACTCCTCTGGCCTATATCTCTGAATTTTCTTA
Associated Phenotype:
Not determined