Busch Lab

ZMP

six2b

Ensembl ID:
ENSDARG00000054878
ZFIN ID:
ZDB-GENE-080723-23
Description:
sine oculis-related homeobox 2b [Source:RefSeq peptide;Acc:NP_001122206]
Human Orthologue:
SIX2
Human Description:
SIX homeobox 2 [Source:HGNC Symbol;Acc:10888]
Mouse Orthologue:
Six2
Mouse Description:
sine oculis-related homeobox 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102778]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16653 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16653
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077155 Nonsense 32 285 1 2
Genomic Location (Zv9):
Chromosome 12 (position 27139491)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25520479
GRCz11 12 25611839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGCGTGTGCGAGRTCCTTCWGCAAGGTGGAAGTATCGAACGTCTTGGA[C/T]GATTTTTGTGGTCTTTACCAGCTTGTGAGCACCTTCACAAAAACGAGAGC
Long Flanking Sequence:
CCCGTATGACTCCCCAGGAGGATGCGCTTGCCGTGCTTACACACTGGCGAATCTGTAAGAGATATGATATCTAGAGGGCGGGCTGATAGCTAAGGACAGTCGAGGAAAGAATCTATTGCGCACGACTAGAGCGCGTAAAAATGAAATGATTAGCGCGTCATGATATTGCAACTAATGTAACTGAGCACTTACGCAAACTTGTTTAAGTGTTTTGCTTATTTTGCTTGATTTTTCTCTTTTTTTTACTTTAAGATGATTTGAATCGCACTTTTTCATGGAAATGCATATCAAAAACTGAAATTCTTTAGTTGCGGAAGAATCATTGCATGAGTTTCCCAAGTGGATTTCGCCTTCAAACCAACGTTAAGAGTGGATAAGATACGCACAGGACATCGTTGCACTTAGCAATGTCTATGCCACCAACTTTTGGATTTACCCAAGAGCAGGTTGCCTGCGTGTGCGAGGTCCTTCAGCAAGGTGGAAGTATCGAACGTCTTGGA[C/T]GATTTTTGTGGTCTTTACCAGCTTGTGAGCACCTTCACAAAAACGAGAGCGTATTGAAAGCGAAAGCAGTAGTAGCTTTCCACCGAGGCAACTTCAGGGAGCTCTACAAAGTATTAGAGAGCCACCAGTTTTCTCCGCACAACCACCCTAAACTTCAACAGCTGTGGCTGAAAGCTCACTATATTGAAGCGGAGAAATTGCGCGGTCGTCCTTTGGGCGCAGTGGGAAAATACCGCGTGCGCAGAAAATTCCCACTGCCTCGCAGCATTTGGGATGGAGAGGAGACCAGCTACTGTTTTAAGGAGAAGAGCCGGTGTGTGCTTAAAGAGTGGTACACCCACAACCCATACCCTTCCCCGAGAGAGAAGAGAGAACTGGCCGAGGCCACGGGTCTCACCACGACTCAGGTCAGCAACTGGTTCAAGAACAGAAGGCAGAGGGATCGTGCCGCTGAAGCCAAAGAAAGGTAGGAGAACTTATTGAGGCTTTTCGCTTTTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27953
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077155 Nonsense 84 285 1 2
Genomic Location (Zv9):
Chromosome 12 (position 27139335)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25520323
GRCz11 12 25611683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGTATTAGAGAGCCACCAGTTTTCTCCGCACAACCACCCTAAACTT[C/T]AACAGCTGTGGCTGAAAGCTCACTATATTGAAGCGGAGAAATTGCGCGGT
Long Flanking Sequence:
GTCATGATATTGCAACTAATGTAACTGAGCACTTACGCAAACTTGTTTAAGTGTTTTGCTTATTTTGCTTGATTTTTCTCTTTTTTTTACTTTAAGATGATTTGAATCGCACTTTTTCATGGAAATGCATATCAAAAACTGAAATTCTTTAGTTGCGGAAGAATCATTGCATGAGTTTCCCAAGTGGATTTCGCCTTCAAACCAACGTTAAGAGTGGATAAGATACGCACAGGACATCGTTGCACTTAGCAATGTCTATGCCACCAACTTTTGGATTTACCCAAGAGCAGGTTGCCTGCGTGTGCGAGGTCCTTCAGCAAGGTGGAAGTATCGAACGTCTTGGACGATTTTTGTGGTCTTTACCAGCTTGTGAGCACCTTCACAAAAACGAGAGCGTATTGAAAGCGAAAGCAGTAGTAGCTTTCCACCGAGGCAACTTCAGGGAGCTCTACAAAGTATTAGAGAGCCACCAGTTTTCTCCGCACAACCACCCTAAACTT[C/T]AACAGCTGTGGCTGAAAGCTCACTATATTGAAGCGGAGAAATTGCGCGGTCGTCCTTTGGGCGCAGTGGGAAAATACCGCGTGCGCAGAAAATTCCCACTGCCTCGCAGCATTTGGGATGGAGAGGAGACCAGCTACTGTTTTAAGGAGAAGAGCCGGTGTGTGCTTAAAGAGTGGTACACCCACAACCCATACCCTTCCCCGAGAGAGAAGAGAGAACTGGCCGAGGCCACGGGTCTCACCACGACTCAGGTCAGCAACTGGTTCAAGAACAGAAGGCAGAGGGATCGTGCCGCTGAAGCCAAAGAAAGGTAGGAGAACTTATTGAGGCTTTTCGCTTTTTACTGTTCACCAAAATTATCATGTTTATACATAAAAAATGCATGCATTTATAAAAGCTATAAGTATTTTAGGTAAATAGCCTAATAATTACAAAACAATTTAATACATAACAAAATAATTACGCTTTAACCGCATTTGATGACATCAGTATGGTATTTA
Associated Phenotype:
Not determined