Busch Lab

ZMP

si:dkeyp-34c12.2

Ensembl ID:
ENSDARG00000054858
ZFIN ID:
ZDB-GENE-050208-453
Description:
tumor protein p53 binding protein, 2 [Source:RefSeq peptide;Acc:NP_001038618]
Human Orthologue:
TP53BP2
Human Description:
tumor protein p53 binding protein, 2 [Source:HGNC Symbol;Acc:12000]
Mouse Orthologue:
Trp53bp2
Mouse Description:
transformation related protein 53 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2138319]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24196 Nonsense Available for shipment Available now
sa43870 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa3156 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa24196
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077117 Nonsense 39 1101 1 19
ENSDART00000129476 Nonsense 28 996 2 16
ENSDART00000136032 Nonsense 25 1060 1 17
Genomic Location (Zv9):
Chromosome 22 (position 31375129)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28869238
GRCz11 22 28818365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGTGACAAGCACTTCACAGAGCTACCGATCACACCGGAGACTCTGTG[T/A]CGAGATGTGCTGGACATGTGTAAAGAGCCGGGAGAAGTGGACTGCTATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43870
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077117 Essential Splice Site 130 1101 5 19
ENSDART00000129476 Essential Splice Site 115 996 5 16
ENSDART00000136032 Essential Splice Site 112 1060 4 17
Genomic Location (Zv9):
Chromosome 22 (position 31390207)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28884316
GRCz11 22 28833443
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTCTATAGCTTTCCAATATAATAAGCTAAATCTTTATATTCTTTT[A/G]GATGGCAGCCCCTCATATGGACATCACTCTCAGCGAGTTGCAAGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3156
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077117 Nonsense 253 1101 7 19
ENSDART00000129476 Nonsense 238 996 7 16
ENSDART00000136032 Nonsense 235 1060 6 17
Genomic Location (Zv9):
Chromosome 22 (position 31392548)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28886657
GRCz11 22 28835784
KASP Assay ID:
554-2549.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCGGGAGCTGGTGGTGGCCGTWAGCAGGGTGGAAGAGTTGAGTCGA[C/T]AACTRGACGTGTTACGTAGTGGAAAAWTGGACATGCCACACGAGGCTGGA
Associated Phenotype:
Not determined