Busch Lab

ZMP

nucb1

Ensembl ID:
ENSDARG00000054833
ZFIN ID:
ZDB-GENE-060825-222
Description:
nucleobindin-1 [Source:RefSeq peptide;Acc:NP_001038928]
Human Orthologue:
NUCB1
Human Description:
nucleobindin 1 [Source:HGNC Symbol;Acc:8043]
Mouse Orthologue:
Nucb1
Mouse Description:
nucleobindin 1 Gene [Source:MGI Symbol;Acc:MGI:97388]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33192 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20030 Essential Splice Site Available for shipment Available now
sa15054 Nonsense Available for shipment Available now
hu7895 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Essential Splice Site 38 454 2 13
Genomic Location (Zv9):
Chromosome 3 (position 30303840)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30021879
GRCz11 3 30152721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACCGCAACCCAGACCCTCCTCAGGAGGAGAAAGCAGAGGAGAATGTGG[T/C]AAGACGGCTCTCGCATCATGCTGTCAGAGCTCATCTTGTGCTCTCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Essential Splice Site 119 454 4 13
Genomic Location (Zv9):
Chromosome 3 (position 30301981)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30020020
GRCz11 3 30150862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTCAGGATGCTGCTGAAGGCTAAACTGGACAGCACCAATGCCCAGAG[T/G]CAGTGTGTTTATGCTTGTGTTGCACTCAGTTGTGCTGATGAATGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15054
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Nonsense 350 454 11 13
Genomic Location (Zv9):
Chromosome 3 (position 30294789)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30012828
GRCz11 3 30143670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGTSTATACAGAAGAGGAGCTGCAGCRCTTTGAGACAGAACTTCGGGAT[A/T]AAGAGCTGGAGCTCGGCAGAAGAGCAGAGAAATTAAGACAGGAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7895
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Nonsense 380 454 11 13
Genomic Location (Zv9):
Chromosome 3 (position 30294699)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30012738
GRCz11 3 30143580
KASP Assay ID:
554-2391.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGCAGGAACTTCTGAAAGAGAGAAGCAAAGCTCTTGAAGCACAGAAA[C/T]GAGAATATCAGCAGGTAAACRGTGTSAAATGTAACAGAGGTGGTTGCTTC
Associated Phenotype:
Not determined