Busch Lab

ZMP

si:dkey-46a10.3

Ensembl ID:
ENSDARG00000054777
ZFIN ID:
ZDB-GENE-030131-4610
Description:
UPF0600 protein C5orf51 homolog [Source:UniProtKB/Swiss-Prot;Acc:A8Y5U1]
Human Orthologue:
C5orf51
Human Description:
chromosome 5 open reading frame 51 [Source:HGNC Symbol;Acc:27750]
Mouse Orthologue:
AW549877
Mouse Description:
expressed sequence AW549877 Gene [Source:MGI Symbol;Acc:MGI:2146232]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061832 Nonsense 45 276 2 6
Genomic Location (Zv9):
Chromosome 8 (position 32561184)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31703910
GRCz11 8 31713142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTNNCCCTAGATGATGACTACTTACAGAATGCATCTTCCATACTTGACAAGT[T/A]GAAAACTTATTATAGACATGGAGGAGAGAGCAGTAGCCTTCCCAAACTGC
Associated Phenotype:
Not determined