Busch Lab

ZMP

SMOC2 (2 of 2)

Ensembl ID:
ENSDARG00000054766
Description:
SPARC related modular calcium binding 2 [Source:HGNC Symbol;Acc:20323]
Human Orthologue:
SMOC2
Human Description:
SPARC related modular calcium binding 2 [Source:HGNC Symbol;Acc:20323]
Mouse Orthologue:
Smoc2
Mouse Description:
SPARC related modular calcium binding 2 Gene [Source:MGI Symbol;Acc:MGI:1929881]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24829 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30522
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077021 Nonsense 10 141 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA529 (position 4429)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43130294
GRCz11 13 43263864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTTTGTCTGTTCTTCCAGTTTCTGCGTGTGGAGCAGGATAAAGAATG[C/A]AACACAGACTGCTCTGGAGCTCCTCGAAAGCCTCTGTGCGCATCAGACGG
Long Flanking Sequence:
GTTTAATAATGATTTAATCAGCTGTAGTAAAAATTACGCTAAGTTTATCTCCTCTAAGGGCTTATTGTGCGGTCTCTGTTGTCATCTTGTGGATGGACAACATCAACCGTCTTTGCTCTACTCAGTACAGGCTGATGGATGATGACGCACTGAATCTACAAAATTATAAATATATAAAAATAGACACTGTCTTTATAAATAAACTGTATAGTTGCAATCTAAACAATTTCATTCTCGACTAATAAGCCTCAAAAGTACATTAAGTTGTACAACAGCTGCAATATTTGTCAAATTGTAGTGAGTTTATTGATCCGCTTTCACTCTATGAGGGCGGAGTACTACACAACAGTGAAGAGGCTGTACAAGTGCTGTTATTACAGGAATATCATACTGCTATGAGCCAATCAGATTCAAGAACTAGACAGAACTGTGGTATAAAGATCAAACATCTCTCTTTGTCTGTTCTTCCAGTTTCTGCGTGTGGAGCAGGATAAAGAATG[C/A]AACACAGACTGCTCTGGAGCTCCTCGAAAGCCTCTGTGCGCATCAGACGGACGGACCTTCAGTTCCCGCTGCGAGTTTCTCCGTGCAAAGTGCCGTGACCCTCAGCTGGCGGTCAGTCGAGGGCAATGCAAAGGTCAGAGTTCAGCAGCCATGAACAGGCCTGATGCCCTGTGAGGGTCCGGGTTCAACACGTCCTCTGAGAAATGATTCTTTGACAGACAGACAGAGCACAGTACAGCTCATTATCATCTTGATGTTTTGAGTAGTGCTTAAATTAAGAATGAATTCAAACTAAGAGCAATTTAAAAATCACAAACTGACCTGAAGTGAGTTGATGATTTGAGGGGACACCAATGATTTACTGACATATTTTTAGCAATTGTTTAGCACTTTATTATTTGTTACTGTCAAAATTTATTCAGACACCTTCAACATTTCTCAATTTTATTCAGTATAGCTTTTGAAAATGGTAACAAATATAACAAGAACTCAGGGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24829
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077021 Essential Splice Site 55 141 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA529 (position 4564)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43130429
GRCz11 13 43263999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAAGTGCCGTGACCCTCAGCTGGCGGTCAGTCGAGGGCAATGCAAAGG[T/G]CAGAGTTCAGCAGCCATGAACAGGCCTGATGCCCTGTGAGGGTCCGGGTT
Long Flanking Sequence:
TGGATGATGACGCACTGAATCTACAAAATTATAAATATATAAAAATAGACACTGTCTTTATAAATAAACTGTATAGTTGCAATCTAAACAATTTCATTCTCGACTAATAAGCCTCAAAAGTACATTAAGTTGTACAACAGCTGCAATATTTGTCAAATTGTAGTGAGTTTATTGATCCGCTTTCACTCTATGAGGGCGGAGTACTACACAACAGTGAAGAGGCTGTACAAGTGCTGTTATTACAGGAATATCATACTGCTATGAGCCAATCAGATTCAAGAACTAGACAGAACTGTGGTATAAAGATCAAACATCTCTCTTTGTCTGTTCTTCCAGTTTCTGCGTGTGGAGCAGGATAAAGAATGCAACACAGACTGCTCTGGAGCTCCTCGAAAGCCTCTGTGCGCATCAGACGGACGGACCTTCAGTTCCCGCTGCGAGTTTCTCCGTGCAAAGTGCCGTGACCCTCAGCTGGCGGTCAGTCGAGGGCAATGCAAAGG[T/G]CAGAGTTCAGCAGCCATGAACAGGCCTGATGCCCTGTGAGGGTCCGGGTTCAACACGTCCTCTGAGAAATGATTCTTTGACAGACAGACAGAGCACAGTACAGCTCATTATCATCTTGATGTTTTGAGTAGTGCTTAAATTAAGAATGAATTCAAACTAAGAGCAATTTAAAAATCACAAACTGACCTGAAGTGAGTTGATGATTTGAGGGGACACCAATGATTTACTGACATATTTTTAGCAATTGTTTAGCACTTTATTATTTGTTACTGTCAAAATTTATTCAGACACCTTCAACATTTCTCAATTTTATTCAGTATAGCTTTTGAAAATGGTAACAAATATAACAAGAACTCAGGGTATTTACTTTATTTAGCTGTCCTTACTGTAGTGTCCCAAAAATATCAAAAATTATATTTGGTGTCTCAATAATATTTAGTTTTGGCTGTATGTTATTTAATATATTATAGAAATAAACATAACTTATTAAAGAAATAAAA
Associated Phenotype:
Not determined