Busch Lab

ZMP

lmo4b

Ensembl ID:
ENSDARG00000054749
ZFIN ID:
ZDB-GENE-030131-3570
Description:
LIM domain transcription factor LMO4 [Source:RefSeq peptide;Acc:NP_997854]
Human Orthologue:
LMO4
Human Description:
LIM domain only 4 [Source:HGNC Symbol;Acc:6644]
Mouse Orthologue:
Lmo4
Mouse Description:
LIM domain only 4 Gene [Source:MGI Symbol;Acc:MGI:109360]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8463 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40693 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8463
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076997 Essential Splice Site 112 165 4 5
Genomic Location (Zv9):
Chromosome 6 (position 25678448)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25953131
GRCz11 6 25943692
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATGTGCTAAGGAKTGTGTGTAATGTAGTTCTTTTGTTTTGTTTCCTGC[A/T]GTGTTTCACATGTTCTACCTGCCGGAACCGGCTTGTCCCTGGKGACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076997 Nonsense 154 165 4 5
Genomic Location (Zv9):
Chromosome 6 (position 25678320)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25953003
GRCz11 6 25943564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAACACGACAGACCCACAGCACTCATCAATGGCCATTTGAGTTCATTG[C/T]AGACTAACCCTCTACTGCCTGACCAGAAAGTAAGAGCCATAGTCGGTCAT
Associated Phenotype:
Not determined