Busch Lab

ZMP

im:7153552

Ensembl ID:
ENSDARG00000054707
ZFIN ID:
ZDB-GENE-050809-39
Human Orthologue:
DHX8
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 8 [Source:HGNC Symbol;Acc:2749]
Mouse Orthologue:
Dhx8
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 8 Gene [Source:MGI Symbol;Acc:MGI:1306823]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa22114 Nonsense Available for shipment Available now
sa22113 Nonsense Available for shipment Available now
sa44765 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6254 Nonsense Mutation detected in F1 DNA Not yet available
sa13601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22114
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 89 1210 3 23
Genomic Location (Zv9):
Chromosome 12 (position 29157934)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27495543
GRCz11 12 27586903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTCGTCTCATTCAAACAATGCGCCCTCCTGCAAAAGCATCTACCAGT[A/T]AAGGTAAGTGCATTTTGGATCAGTTTACAGAATAGCAGCTCATATTGATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27961
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Essential Splice Site 120 1210 4 23
Genomic Location (Zv9):
Chromosome 12 (position 29157672)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27495281
GRCz11 12 27586641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAGAGCTTTTCCCAGCTCTCTGCAGACCTGATAATCCTACTACCAGGG[T/A]ACTTATTTATAATTTACCTTAATGCATACATATTTGGCTTATTTAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22113
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 597 1210 13 23
Genomic Location (Zv9):
Chromosome 12 (position 29151227)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27488836
GRCz11 12 27580196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGGGAAGACCACTCAGATCACACAATACCTGGCAGAAGCAGGATA[C/A]ACCACACGAGGGAAGATTGGGTGCACACAACCCAGAAGAGTGGCTGCTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27960
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 628 1210 13 23
Genomic Location (Zv9):
Chromosome 12 (position 29151135)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27488744
GRCz11 12 27580104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTGCTATGTCTGTGGCTAAAAGAGTGTCTGAAGAGTACGGTTGTTGTT[T/A]AGGTCAAGAGGTAGGTCATTACTAGGAATGGTGAAAAATAGTTTTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44765
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Essential Splice Site 693 1210 14 23
Genomic Location (Zv9):
Chromosome 12 (position 29147607)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27485216
GRCz11 12 27576576
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGAGAGGACCATCCACACAGACGTGCTCTTCGGCCTTCTCAAGAAGG[T/A]ACAATTCACATTTTAGACTTTGTTAGTCAGTCTCTATACTGTTCAGAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27959
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 716 1210 15 23
Genomic Location (Zv9):
Chromosome 12 (position 29147357)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27484966
GRCz11 12 27576326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACATGAAGCTCATTGTGACATCTGCCACACTGGATGCCGTGAAATTCT[C/A]ACAGTACTTTTATGAAGCACCTATTTTTACAATCCCTGGTCGTACATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6254
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 746 1210 15 23
Genomic Location (Zv9):
Chromosome 12 (position 29147266)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27484875
GRCz11 12 27576235
KASP Assay ID:
554-5406.1 (used for ordering genotyping assays)
KASP Sequence:
CGTACATACCCGGTAGAGGTTTTGTATACAAAAGAACCTGAAACTGACTA[T/A]CTGGATGCCAGTCTGATCACAGTCATGCAGATTCACCTCACTGAACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13601
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 1060 1210 21 23
Genomic Location (Zv9):
Chromosome 12 (position 29144069)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27481678
GRCz11 12 27573038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACAACAAGTTTTYYAACCCCTGGTGTTACGAGAACTTCATTCAAGYC[C/T]GATCTCTYCGACGTGCACAGGATATCCGCAAACAGATGCTGGGCATCATG
Associated Phenotype:
Not determined