Busch Lab

ZMP

fli1a

Ensembl ID:
ENSDARG00000054632
ZFIN ID:
ZDB-GENE-980526-426
Description:
Friend leukemia integration 1 transcription factor [Source:RefSeq peptide;Acc:NP_571423]
Human Orthologue:
FLI1
Human Description:
Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
Mouse Orthologue:
Fli1
Mouse Description:
Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43180 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4770
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041354 Essential Splice Site 127 450 None 10
ENSDART00000076861 Essential Splice Site 128 451 None 9
ENSDART00000098459 Essential Splice Site 152 200 None 9
ENSDART00000134817 None 86 212 2 6
ENSDART00000137978 Essential Splice Site 95 123 None 4
ENSDART00000147074 Essential Splice Site 152 200 None 4
Genomic Location (Zv9):
Chromosome 18 (position 47010759)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48452450
GRCz11 18 48447147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCCTCCAAACATGACGACCAATGAGAGGAGAGTCATCGTCCCCGCAGG[T/C]GAATACTGCATAAGTATGTTTAAATGAGAATTCGAATGMTGTRTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43180
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041354 Nonsense 421 450 10 10
ENSDART00000076861 Nonsense 422 451 9 9
ENSDART00000098459 None None 200 9 9
ENSDART00000134817 None None 212 None 6
ENSDART00000137978 None None 123 None 4
ENSDART00000147074 None None 200 None 4
Genomic Location (Zv9):
Chromosome 18 (position 47049926)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48491617
GRCz11 18 48486314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAATGCCCGTCACCTCCTCCAACTTCTTCGGTCCCACAACCCCATACT[G/A]GAGCTCCCCACCAGGAGGTATTTACCCCAATCCCAGCGTCCCACGCCATG
Associated Phenotype:
Not determined