Busch Lab

ZMP

ENSDARG00000054572

Ensembl ID:
ENSDARG00000054572
Mouse Orthologue:
4930434E21Rik
Mouse Description:
RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35926 Nonsense Mutation detected in F1 DNA Not yet available
sa24991 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076793 Nonsense 48 515 2 18
Genomic Location (Zv9):
Chromosome 15 (position 30842763)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31664470
GRCz11 15 31545211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCCAACAGGGATTTTGAAAGGTCACTCCGCCCCTGTTGCCTACGTCTG[T/A]GTCACGTCAGAGAATGGACACATTTACTCAGTGTCCACAGACAACACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24991
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076793 Essential Splice Site 67 515 3 18
Genomic Location (Zv9):
Chromosome 15 (position 30846913)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31668620
GRCz11 15 31549361
KASP Assay ID:
554-7337.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCAACATAAATATGAAAACGTATGATTTTTTTATCATGCTTTTTTTTC[A/T]GATATGGCATATAAAGGACCAGACGTGTCTGTTTACTGCACATCCAAATT
Associated Phenotype:
Not determined