Busch Lab

ZMP

A7MC21_DANRE

Ensembl ID:
ENSDARG00000054548
Description:
LOC562362 protein [Source:UniProtKB/TrEMBL;Acc:A7MC21]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13362 Nonsense Available for shipment Available now
sa8482 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7255 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13362
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Nonsense 164 260 3 4
Genomic Location (Zv9):
Chromosome 23 (position 43925429)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43955596
GRCz11 23 43757114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCTCTTCACCAGAGGAGATGATCTAAAGAASAAGACCATTGAAGAGTA[T/A]CTGGGTGCACCTGGATCTGCTCTAATGARCCTCATTGAACAGTGTGGARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Essential Splice Site 258 260 3 4
ENSDART00000076761 Essential Splice Site 258 260 3 4
Genomic Location (Zv9):
Chromosome 23 (position 43925713)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43955880
GRCz11 23 43757398
KASP Assay ID:
554-4463.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAAAGAGAAARATGAACTYATTTCCAAACATGAAGAAGAGAAARAAA[G/A]WATAAAGATGAAGATGGAGGAAGAAAAAAAGRCACTTCAAWATAAATTYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7255
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Essential Splice Site 258 260 3 4
ENSDART00000076761 Essential Splice Site 258 260 3 4
Genomic Location (Zv9):
Chromosome 23 (position 43925713)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43955880
GRCz11 23 43757398
KASP Assay ID:
554-4463.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAAAGAGAAARATGAACTYATTTCCAAACATGAAGAAGAGAAARAAA[G/A]WATAAAGATGAAGATGGAGGAAGAAAAAAAGRCACTTCAAWATAAATTYC
Associated Phenotype:
Not determined