Busch Lab

ZMP

samsn1a

Ensembl ID:
ENSDARG00000054543
ZFIN ID:
ZDB-GENE-030131-8639
Description:
SAM domain, SH3 domain and nuclear localisation signals, 1a [Source:RefSeq peptide;Acc:NP_001122141
Human Orthologue:
SAMSN1
Human Description:
SAM domain, SH3 domain and nuclear localization signals 1 [Source:HGNC Symbol;Acc:10528]
Mouse Orthologue:
Samsn1
Mouse Description:
SAM domain, SH3 domain and nuclear localization signals, 1 Gene [Source:MGI Symbol;Acc:MGI:1914992]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa17145 Essential Splice Site Available for shipment Available now
sa7235 Nonsense Mutation detected in F1 DNA Not yet available
sa2821 Nonsense F2 line generated Not yet available
sa28476 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3927
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Essential Splice Site 57 621 3 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28932042)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29650072
GRCz11 15 29582948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAGTTCATATTGCAAAAGTTCTAAACTGCTTACTGTATTTACTTTTTC[A/T]GGAAATGTCACAAATCAACCCAGACAATAGAAAAAAGAAACAAAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3938
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 91 621 5 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28930682)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29648712
GRCz11 15 29581588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACACTGGTTTTGCTTTTCTTTTTGCAGATAACACACTCGGCACTAATT[C/A]GGTCTGGCCAGCTGCCAAAAAGCAGGAAGATTTAGTCCTCCTGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17145
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Essential Splice Site 112 621 6 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28928297)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29646327
GRCz11 15 29579203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GWTGCACAGTGACATTTRAAAACTAAATAGGTCRAATRTGTTTGCATTTC[A/T]GATCTGAGGAGAGCTGTAAGGACAGAAAACCAGACAATGGCAAACTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7235
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947 None None 333 None 8
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643676
GRCz11 15 29576552
KASP Assay ID:
554-3317.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGATYCTAGTAAAGGTGCCAAAGGAACGATGCCTGATGTWGGGATGTG[G/A]TCACAAAATCCGGATATATCTTGTACCTCTGAAGGTTTGAGGGTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2821
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947 None None 333 None 8
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643676
GRCz11 15 29576552
KASP Assay ID:
554-3317.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGATCCTAGTAAAGGTGCCAAAGGAACGATGCCTGATGTAGGGATGTG[G/A]TCACAAAATCCGGATATATCTTGTACCTCTGAAGGTTTGAGGGTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28476
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 287 621 9 16
ENSDART00000099947 None None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925426)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643456
GRCz11 15 29576332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCCAGAAACAGGAGTCAAGGAGACAAAATCAATGGCCCAAATATGAAG[A/T]GAGACTCCTTGCCCAAAGGAATGATGCGCTCCACGACCAGTGTAGATTTC
Associated Phenotype:
Not determined