Busch Lab

ZMP

nhsl1a

Ensembl ID:
ENSDARG00000054537
ZFIN ID:
ZDB-GENE-050411-25
Human Orthologue:
NHSL1
Human Description:
NHS-like 1 [Source:HGNC Symbol;Acc:21021]
Mouse Orthologue:
Nhsl1
Mouse Description:
NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36448 Nonsense Available for shipment Available now
sa28880 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa803 Nonsense F2 line generated Not yet available
sa28881 Nonsense Mutation detected in F1 DNA Not yet available
sa32160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36448
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076739 Nonsense 82 1535 2 8
Genomic Location (Zv9):
Chromosome 17 (position 30633189)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30557116
GRCz11 17 30574079
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTACACAGCCCCCTGGCACCACCAAGAGAACGTCTTCCTGCCTGGGTCC[A/T]GACCAGCATGTGTTGAGGATCTTCACCGTCAGGCCAAAGTCAACCTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28880
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076739 Essential Splice Site 144 1535 3 8
Genomic Location (Zv9):
Chromosome 17 (position 30640108)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30564035
GRCz11 17 30580998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTTGTGAAAGTGTACATCTGGATGAAGAGAAGACAAAGAAAAAGAAG[G/A]TTGATACACATTACAATCCGTTCCTCTAAATTCAAATGCACGCAATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa803
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076739 Nonsense 737 1535 6 8
Genomic Location (Zv9):
Chromosome 17 (position 30644014)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30567941
GRCz11 17 30584904
KASP Assay ID:
554-0708.1 (used for ordering genotyping assays)
KASP Sequence:
CCAACACACAGTGACWGCAGCAGTCAGCGCTCAGACTATGCAGAGTCATG[G/A]GACTTCTACATGGATTGCCCATGTMCACGGTCTGACCAGAGTCTTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28881
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076739 Nonsense 1484 1535 8 8
Genomic Location (Zv9):
Chromosome 17 (position 30648648)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30572575
GRCz11 17 30589538
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAAATATGGGCGCTCGCGCACACCACCTTCCGCAGCCAGCAGCCGGTA[T/A]AACAGCCGCAGCCGGATTACCAGTAGGCCAATGACTGCCATCTGTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32160
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076739 Nonsense 1501 1535 8 8
Genomic Location (Zv9):
Chromosome 17 (position 30648697)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30572624
GRCz11 17 30589587
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACAGCCGCAGCCGGATTACCAGTAGGCCAATGACTGCCATCTGTGAA[C/T]GAGATGGAGAGGTGGCTGAATCTACAGACTGCTACTTAAGTAGCGAGAAT
Associated Phenotype:
Not determined